Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

... Authors Journal compilation ª 2006 FEBS 2721 EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄ threonine kinases and phosphatase in Mycobacterium tuberculosis Kirti ... kinase-associated protein phosphatase, a phosphoprotein-binding domain. Proc Natl Acad SciUSA 96, 7821–7826.32 Chopra P, Singh A, Koul A, Ramachandran S, DrlicaK, Tyagi AK & Singh Y (2003) Cytotoxic activity ... Sharma1, Meetu Gupta1, Ananth Krupa2,*, Narayanaswamy Srinivasan2 and Yogendra Singh11 Institute of Genomics and Integrative Biology, Delhi, India2 Molecular Biophysics Unit, Indian Institute...

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding speciﬁcity pdf

... axis, all of the inter-actions reported below are repeated twice; that is, if Ala25 of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B.Chain A Chain B ... protein is erucamide, but the shape and size of the cavity clearly indicate that inside the protein there is space for a roughly linear chain of about 22carbon atoms. The presence of a consistent ... be involved in thestimulation of angiogenesis, to inhibit intestinal diar-rhea, and to regulate ﬂuid volumes in other organs[23]. At the same time, erucamide is a contaminant of plastic materials,...

Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

... Nakamura W, Hirano K, Yuasa H,Tsukamoto T & Tatematsu M (1998) Expression of sucrase and intestinal-type alkaline phosphatase in colorectal carcinomas in rats treated with methylazoxy-methanol ... molecular regulatorsresponsible for intestinal epithelial establishment,determination and maturation is crucial to theprovision of a better understanding of the intestinalhomeostasis that is challenged ... gift of the microarray data analysis that was originally per-formed at the Penn Microarray Facility (University of Pennsylvania, Philadelphia, PA, USA). We also thankDrs Angus M. Sinclair and...

Tài liệu Báo cáo khoa học: "Word Alignment for Languages with Scarce Resources Using Bilingual Corpora of Other Language Pairs" pptx

... pivot language. Although only small amounts of bilingual data are available for the desired language pair L1-L2, large-scale bilin-gual corpora in L1-L3 and L2-L3 are available. Using these ... are available for the desired lan-guage pair L1-L2, large-scale bilingual corpora in L1-L3 and L2-L3 are available. Based on these two additional corpora and with L3 as the pivot language, ... corpus is available for this language pair. In addition, using the small bilin-gual corpus in L1 and L2, we train another word alignment model for this language pair. Here, we call this model an...

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... generalmechanism for furin-mediated activation of transmem-brane substrates. The activation of ADAM17 by furin[68] and our observation of an interaction betweenGRASP55 and the ICD of ADAM17 ... 3169MT1-MMP and furin can interact with GRASP55.Overexpression of GRASP55 has been found toincrease the amount of complex containing MT1-MMP and furin, and the expression of a catalyticallyinactive ... analysisStatistical analysis was performed using the graphpadprism, version 5 (GraphPad Software, Inc., San Diego, CA,USA). Statistical signiﬁcance was calculated using Student’st-test. Statistical...

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING ﬁnger protein Unkempt doc

... ubiqui-tination. We have identified and characterized a signal-ling process involving Rac GTPase and a novelpartner of activated Rac, the RING finger protein Unkempt, which binds to BAF60b and promotes ... ubiquitination.ResultsUnkempt protein binds specifically to activatedforms of RacGTPases In a two-hybrid screen for partners of activatedRacGTPase, we isolated a human cDNA sequence with a partial ... molecular composi-tion of the E3 ligase involved and the role of UnkemptRING finger remain uncertain. On the basis of theresults of a mutational analysis (Figs 3 and S1), itappears that the RING...

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT135mC9.R: GGCTTCCATGGCATACTCCACARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC706mCARP.R: TGGCACTGATTTTGGCTCCTE2-14 ... hae-matoxylin–phloxin–safran histological staining. For deter-mination of the number and minimal diameter of ﬁbres,histochemical immunostaining with a rabbit polyclonalantibody against laminin (Dako, Trappes, France; ... muscleremodelling in skeletal muscle.AbbreviationsAAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI,4¢,6-diamidino-2-phenylindole;...

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... values over 0.75 are shown. Blackgeometrical shapes are additional domains, as indicated. ANOGA,Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachyda-nio rerio; CANDGLA, Candida glabrata; ... analyses of all splice variants link DIDO1 toother distantly related protein families involved in DNA binding and chromatin stability. Moreover,additional experimental data place the DIDO protein in ... simulta-neously to maintain transcription.The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain showing the samearchitecture as the DIDO1 long isoform, although lack-ing the...

Báo cáo khoa học: PA700, the regulatory complex of the 26S proteasome, interferes with a-synuclein assembly pptx

... aggregation kinetics is triphasic, with an inital lag phase, followed by anexponential growth phase and ending with a steadystate phase [4]. Figure 1A and C illustrate that a decrease in protein ... Strikingly, however, the lag phases of both WT and A5 3T a- synucleins and the elongation rates remainconstant. One expects a dramatic increase of the lagphase and a signiﬁcant decrease of the ... 2-mercaptoethanol) and increasing concentrations of PA700 as indicated. A total volume of 100 lL was aliquottedper well of a 96-well plate containing a Teﬂon sphere in eachwell. The samples were incubated at...

Báo cáo khoa học: Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 doc

... CATCTTCTCAAAATTCGAGTGACAAReverse: TGGGAGTAGACAAGGTACAACCCRTPrimerDB 147TTP Forward: TGCAATAACCCATTTCCCTGGTGCReverse: TAGGAACGGATCCACCCAAACACT–TIA-1 Forward: TTGTCAGCACACAGCGTTCACAAGReverse: AGGCTGCTTTGATGTCTTCGGTTG–HuA ... databaseGAPDH Forward: TTCACCACCATGGAGAAGGCReverse: GGCATGGACTGTGGTCATGARTPrimerDB 2920FXR1 Forward: ATAATTGGCAACCAGAACGCCAGGReverse: CCACATGGCTCTTGGTCATTTGCT–TNF -a Forward: CATCTTCTCAAAATTCGAGTGACAAReverse: ... TGF-b1.DiscussionRegulation of TNF -a plays a central role in autoim-mune disease [41–44], and therapy targeting TNF -a is effective in patients with in ammatory disorders suchas uveitis and rheumatoid arthritis [45–49]....

Xem thêm