0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

... 335 Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant Laura Ciudad, Maria-Dolors Piulachs and Xavier Belle´sDepartment ... beginning of the last nymphal instar, steadily declining along the instar, and reaching the lowest values of the instarbefore the imaginal moult (Fig. 3A) . In the adult,mRNA levels remained ... clearer on day 6than on day 4 of adult life. On day 6, the vitellogenin accumulated in the haemolymph of dsBgVgR-treatedwas processed in a similar manner to that of vitellin in the ovary of...
  • 11
  • 414
  • 0
Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

... temperature, are different from a protein that has evolved to be hyperthermostable as a consequence of the adaptation to a factor other thanelevated temperature. The availability of an increasing ... Q4 0A mutant in the gp41model. We have created a triple mutant: Q4 0A/ Q4 1A/ Q5 1A. The three amino acids mutated are mainly involved in interactions amongst the three helices N. This mutant wassubstantially ... the loop are the reason for aggregation atneutral pH. However, the mutation of an additionalamino acid in the loop appears to be necessary to furtherincrease protein solubility.Amino acid residues...
  • 14
  • 375
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "BOTTOM-UP PARSING EXTENDING GRAMMAR CONTEXT-FREENESS PROCESSOR IN A PROCESS" potx

... example appropriate links are created by means of the actions, and the advantage of this solution is that the search process terminates in a natural way without searching and proposing useless ... cycle in a parsing process, but an analysis of the activation mechanism of the processes by means of two main cases of rule scheduling and processing. Scheduling and Processing of Standard Rules. ... has. As a matter of fact, our PGS can be seen as a denotational variant of the chart, and it is managed in a different way by the PG Processor since in the PGS we mainly use classical relations...
  • 8
  • 438
  • 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. ... Chaperones 8, 381–394.70 Rajaraman K, Raman B, Ramakrishna T & Rao CM(2001) Interaction of human recombinant aA- andaB-crystallins with early and late unfolding intermedi-ates of citrate ... Scharf K-D, Siddique M & Vierling E (2001) The expanding family of Arabidopsis thaliana small heatstress proteins and a new family of proteins containing a- crystallin domains (Acd proteins)....
  • 15
  • 515
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "SYSTEMIC GRAMMAR IN COMPUTATION: THE NIGEL CASE" ppt

... organization of grammar. The important point to note here is that the organization of systemic grammar leads naturally to a factoring of the sentence generation process. In other words, the systemic ... local plan for CATHEDRAL-BUILDING in the text plan for an independent clause. Such a plan includes among other things: . A pointer to the process aspect of CATHEDRAL. BUILDING, called BUILDING ... t° or a grammatical function and a set of features, tl A realization statements consisting of an operator and one or more operands is associated with a particular grammatical feature in a system;...
  • 10
  • 375
  • 0
Báo cáo khoa học: An Escherichia coli twin-arginine signal peptide switches between helical and unstructured conformations depending on the hydrophobicity of the environment potx

Báo cáo khoa học: An Escherichia coli twin-arginine signal peptide switches between helical and unstructured conformations depending on the hydrophobicity of the environment potx

... itcontacts the translocase. In pathway B, the signal interactsdirectly with the translocase and the helical conformation isgenerated either during entry into the interfacial region orafter the initial ... therefore also analyzed mutant variants that are not recognized by the Tat system. In this way, wesought to determine whether the significance of the twin-arginine motif stems from the nature of the ... sequence in a specific manner because a mutant version of the peptide containing twin-lysinecontains almost exactly the same amount of a- helicalstructure. This finding strongly suggests that the realsignificance...
  • 8
  • 330
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "An Online System for Corpus Management and Analysis in Support of Computing in the Humanities" pot

... resource.Since the output of the tagger is a XML documentit is stored as a XML Database. Finally the in- formation about the new document is stored in the Master Data including a reference to the originalone ... environmentshowing the document manager and administra-tion dialog.using a standard browser. Figure 1 shows the desk-top with the Document Manager and the Adminis-tration Dialog opened. In the following ... Systems(CMS). Apart from the aspect of pure resourcemanagement, processing and analysis of docu-ments have traditionally been the domain of desk-top applications. Sometimes even to the point of command...
  • 4
  • 338
  • 0
Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

... into two fragments: the A chaincorresponding to the catalytic domain (C domain);and the B chain corresponding to the translocationdomain (T domain) and the receptor- binding domain. The C and ... triggers a conformational change, leading to insertion of the toxin in the membrane. The C domainis then translocated across the endosomal membraneinto the cytosol. The C domain ADP-ribosylates the elongation ... close to the theoreticalmolecular mass of a dimer (44.6 kDa). At pH 4.0, the elution volume of the T domain was quite similar to that of the dead volume (Fig. 7A) . According to a gen-eral estimation,...
  • 10
  • 530
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... AGCACTGTGTTGGCGTACAGHOXC13-ORF GGAAGTCTCCCTTCCCAGAC CGATTTGCTGACCACCTTCTMLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATCMLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAAMLL3 AAGCAAACGGACTCAGAGGA ... CGCGGGTAGTAGAAGTGGAAHOXC13-ERE4 TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACCERa antisense CATGGTCATGGTCAG a ERb antisense GAATGTCATAGCTGA a MLL1 antisense TGCCAGTCGTTCCTCTCCAC a MLL2 antisense ACTCTGCCACTTCCCGCTCA a MLL3 ... demonstrated that E2-induced binding of each of the MLLs to the HOXC13 promoter was mediated via interaction(direct or indirect via other MLL-interacting proteins)with ERa and ERb. A β-actin Input...
  • 12
  • 518
  • 0
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... Toyobo (Osaka, Japan), and New EnglandBiolabs (Beverly, MA, USA). All other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) andWako Pure Chemical Industries (Osaka, Japan).Culture ... Similar results were obtainedwith various concentrations of NADPH and fixed con-centrations of pyruvate. These indicate a sequentialmechanism for the NMAADH reactions. In fact, the data obtained ... use ammonia as a substrate and was distinctfrom alanine dehydrogenase [18] and N-methylalaninedehydrogenase found by Lin & Wagner [17]. Lysineand ornithine were inert as an amine substrate;...
  • 7
  • 518
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ