Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... Bxe _A2 876 (accession numbergi:91782944) was amplified from genomic DNA of B. xenovo-rans LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in theacquisition of CD and DLS data is gratefully acknowl-edged. ... Fe2+display a remarkablyconserved structure [2,17–19]. A facial triad of twohistidines and one carboxylate residue (aspartate orglutamate), exemplified by the metal centers of a large class of 2-ketoglutarate-dependent...
- 15
- 624
- 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAGACTAGTGGTTAGAGGAGAGGAATGATGCTGTAGAGACADENV-1 10482106611791G4P217 Group 4 ATATGCTGAAACGCGTGAGCATCATGAGACAGAGCGATDENV-3 1043822791G5P30 Group 5 TTCCAACAAGCAGAACAACATGCTACAGGCAGCACGGTTTDENV-4 ... CAGACTAGTGGTTAGAGGAGAGGAATGATGCTGTAGAGACADENV-1 92.1 ± 0.57 73.6 ± 2.311G4P217 ATATGCTGAAACGCGTGAGCATCATGAGACAGAGCGATDENV-3 90.3 ± 1.09 83.9 ± 5.161G5P30 TTCCAACAAGCAGAACAACATGCTACAGGCAGCACGGTTTDENV-4 81.8 ... CAAACCATGGAAGCTGTACGTTCTGTGCCTGGAATGATGCTDENV-2 98.9 ± 6.23 98.9 ± 6.232G2P5 GAGTGGAGTGGAAGGAGAAGGGCCTCTTGGTGTTGGTCTTTGCDENV-2 98.4 ± 0.84 98.4 ± 0.841G3P6 CAGACTAGTGGTTAGAGGAGAGGAATGATGCTGTAGAGACADENV-1...
- 12
- 795
- 0
Tài liệu Báo cáo khoa học: "Automatic Detection of Nonreferential It in Spoken Multi-Party Dialog" doc
... shallow feature generation meth-ods could propagate into the model that waslearned from the data. The advantage of this ap-proach is, however, that training and test data arehomogeneous. A ... .58Table 1: Classification of it by two annotators in a corpus subset.4 Automatic Classification4.1 Training and Test Data Generation4.1.1 SegmentationWe extracted all instances of it and the ... of the classnonreferential. The overall classification accuracywas 75.1%.The advantage of using a machine learning sys-4http://www.cs.waikato.ac.nz/ ml/tem that produces human-readable models...
- 8
- 436
- 0
Báo cáo khoa học: Selective inhibition of ADAMTS-1, -4 and -5 by catechin gallate esters ppt
... Llamazares, M., Garabaya, C., Quesada, V.& Lopez-Otin, C. (2002) Cloning, expression analysis, and struc-tural characterization of seven novel human ADAMTSs, a family of metalloproteinases ... demonstrated that ADAMTS-1 is capable of generating similar aggrecan fragments to those produced by ADAMTS-4 and -5 [24]. The finding in a differentlaboratory that ADAMTS-1 failed to cleave aggrecan ... activity by catechin gallate estersCatechins and gallates were also analysed for inhibitorypotential against collagenase-1 (MMP-1) and collagenase-3(MMP-13), as well as ADAM-10 as a representative...
- 10
- 416
- 0
Báo cáo khoa học: "Automatic Detection of Grammar Elements that Decrease Readability" pdf
... level. A grammar element is a grammatical phenomenonconcerned with readability, and its readability levelindicates the familiarity of the grammar element.In Japanese, grammar elements are classified ... Automatic Detection of Grammar Elements that Decrease ReadabilityMasatoshi Tsuchiya and Satoshi SatoDepartment of Intelligence Science and Technology,Graduate School of Informatics, ... but also ” in English. A grammar section exists in a part of the JapaneseLanguage Proficiency Test, which is usedto measureand certify the Japanese language ability of a personwho is a non-Japanese....
- 4
- 398
- 0
Báo cáo khoa học: "SELECTIVE PLANNING OF INTERFACE EVALUATION" pdf
... object is a database system with a natural language interface for users. Ideally. the trials are an instrumented variant of normal uSage. The character of the users, their tasks, the data, and so ... general public alike have shown a great intermit in AI, and a legitimate concern over its social effects- The interest is especially great in natural language precepting. However, neatly all of ... evaluation, whatever they are, can be discarded because they have nothing tO do with the real effects. The effects come from the threat of an evaluation, and they are like the threat of a military...
- 2
- 289
- 0
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt
... ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccasesJuha P. Kallio1, Chiara Gasparetti2, Martina Andberg2, Harry Boer2, Anu Koivula2, Kristiina Kruus2,Juha ... observed for MaL, that may determinethe properties of these asco-laccases at high protein concentrations.DatabaseStructural data are available in the Protein Data Bank database under the accession ... ElectronCorporation, Waltham, MA, USA). The reactions werestarted by addition of substrate, and the rate of substrateoxidation was measured by monitoring the change in absor-bance over 5 min. All of...
- 13
- 888
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... phytate with pH optima in theacidic range. They consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site atthe interface of the two domains [4,5]. HAPs can initi-ate ... substrate-freeAppA the C a atoms are 2.41 A ˚apart, whereas for thesubstrate-free PhyK and the substrate-loaded AppAthe averaged distance is only 1.87 A ˚.Distinct conformational changes ... N-terminal to or inside helix A are separated by large distances. The corresponding region in AppAshows severe conformational changes upon substratebinding. Averaged distances for pairs of C a atomsmatching...
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx
... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- andC-terminal sequences of b-amyrin synthase from ... derivatives. Bioorg Med Chem Lett7, 85–88.51 Banno N, Akihisa T, Tokuda H, Yasukawa K, Higashi-hara H, Ukiya M, Watanabe K, Kimura Y, HasegawaJ & Nishino H (2004) Triterpene acids from ... Yuji Katsube1, Hiroaki Hayashi2, Tetsuo Kushiro1, andYutaka Ebizuka11 Graduate School of Pharmaceutical Sciences, The University of Tokyo, Japan2 Gifu Pharmaceutical University, JapanTriterpene...
- 12
- 704
- 0
Tài liệu Báo cáo khoa học: Subproteomics analysis of Ca2+-binding proteins demonstrates decreased calsequestrin expression in dystrophic mouse skeletal muscle pdf
... Ohkura, M., Furukawa, K ., F ujimori, H., Kuruma, A. ,Kawano, S., Hiraoka, M., Kuniyasu, A. , Nakayama, H. &Ohizumi, Y. (1998) Dual regulation of the skeletal muscle rya-nodine receptor by ... (Temecula, CA, USA).Protran nitrocellulose membranes we re from Schleicherand Schuell (Dasse l, Germany). All other chemicals usedwere of analytical grade and purchased from SigmaChemical Company.Preparation ... Placid, NY , USA; mAb C464.6 t o the a 1-subunit of the Na+/K+ATPase and m Ab VIA41to a- dystroglycan).Peroxidase-conjugated secondary antibodies were obtained from Chemicon International...
- 10
- 588
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP