Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
... andselection of quasispecies during the culture of infectedhepatocytes. To succeed in obtaining HCV infection in primary human hepatocytes, an existing model of hep-atitis B virus infection ... summary, use of HCV-containing sera to recon-stitute the entire life cycle of HCV in vitro has proved to be very difficult. Although infection of primary cellshas been shown with convincing data, ... particles pro-duced in insect cells using a recombinant baculoviruscontaining the cDNA of HCV structural proteins of genotype 1b or 1a [48]. HCV-like particles wereobserved by electron microscopy...
- 14
- 532
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE 61 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢GCE ... 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢GCE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢CLS 16 5¢-TAGGTACGGTCCATGC-3¢GTS 16 5¢-GCATGGATCGTACCTA-3¢GCS ... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE...
- 16
- 397
- 0
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx
... thespeci c binding of HB-19 to surface nucleolin occursthrough the arginine-rich basic C- terminal tail of nucleolin[26]. The fact that hLf and HB-19 compete with each otherfor binding to surface ... binding to nucleolin, suggest that the C- terminal tail of nucleolin should be implicated in themechanism of binding of Lf to nucleolin. In general, the crosslinking of a ligand leads to the clus-tering ... examinedusing an LSM 510 confocal microscopic system (Carl Zeiss,Esslingen, Germany). Procedures used to evidence capping of surface nucleolin on MT-4 cells and endocytosis of hLfinto CHO cells...
- 15
- 509
- 0
Báo cáo khoa học: Recent insights into cerebral cavernous malformations: the molecular genetics of CCM pot
... the advances in CCM molecu-lar genetics and the remaining gaps in this field. In addition to the identification of CCM genes, a number of recent biochemical in vitro studies and in vivo CCManimal ... familieslinked to the CCM1 locus [8]. In Caucasian families,the proportions of families linked to each CCM locuswere 40% (CCM1), 20% (CCM2) and 40% (CCM3)[7]. The three genes located at these loci ... [9–13].The CCM1 gene contains 16 coding exons whichencode for Krit1, a 736-amino acid protein containingthree ankyrin domains and one band 4.1 ezrin radixinmoesin (FERM) domain. CCM2, a 10-exon...
- 6
- 356
- 0
Báo cáo khoa học: Utilizing logical relationships in genomic data to decipher cellular processes pptx
... hereafter as an information coefficient) comparingeither the logically combined vectors or individual vec-tors A or B with vector C, conditioned on the infor-mation available in vector C, and where ... regardingwhich proteins and protein interactions affect a change in measurable phenotypic outcome.ConclusionsThe ultimate goal of genomics research is to describethe cellular networks of molecules ... (TRHDE),protein tyrosine phosphatase, receptor type (PTPRT),cadherin 12 (CDH12), and cyclin-dependent kinase 5,regulatory subunit 2 (CDK5R2) all appear to fulfilroles of inhibitory regulators of cell growth...
- 9
- 315
- 0
Báo cáo khoa học: "Sparse Information Extraction: Unsupervised Language Models to the Rescue" pptx
... research to compare them, as described be-low. To assess each extraction, we determine how sim-ilar its context vector is to a canonical seed vec-tor (created by summing the context vectors of ... poten-tial to improve type checking accuracy. For exam-ple, consider comparing Pickerington, a sparsecandidate argument of the type City, to the seedargument Chicago, for which the following twophrases ... approach these contexts offerno evidence that Pickerington and Chicagoare of the same type. For a sparse token likePickerington, this is problematic because thetoken may never occur in a context...
- 8
- 287
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... linear PCR, using the followingmutagenic oligonucleotides: 5¢-CGCGATGTATGCGCTCAAGATCCTCGTGGCC-3¢ and 5¢-GGCCACGAGGATCTTGAGCGCATACATCGCG-3¢. The mutationintroduced an additional restriction ... DpHdifferences the Ôacidic Õ solution contained 20 mMTricineinstead of succinic acid. Assuming complete equilibration of the K+during the 1 h preincubation (see above), thevalue of t he K+/valinomycin ... evaluated followingthe electrochromic signal of endogenous carotenoid [41].The c oncentration of photo-oxidizable reaction centre(RC) and of total photo-oxidizable cytochrome (c 1+ c 2)were...
- 9
- 580
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... CTGAGGTTACAGACAACTGTTC13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE6 5c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE6 5c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE65a-His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE6 5c- His-FwdNM_001113653 ... TGCARRAAYATHTTYTCCAGDeg RPE65-Rev AYRAAYTCRWRBCCYTTCCARPE65a-FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE65a-Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE6 5c- FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE6 5c- Rev ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE6 5c- His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011)...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx
... employingthis approach, close to 70% inhibition of viral infec-tion was achieved in cell lines stably transduced withan expression vector encoding short hairpin RNAagainst the CCR5 receptor. Similarly, ... Bruton’s tyrosine kinase; EBV, Epstein–Barr virus; ITK, inducible T-cell kinase; NKT cell,natural killer T cell; PH, pleckstrin homology; PKB, protein kinase B; R2 8C, arginine 28 mutated to cysteine; ... T-cell kinase (ITK) could in uence the infectivity of HIVand also have anti -in ammatory activity. Since 2006, several patients carry-ing a fusion protein, originating from a translocation joining...
- 10
- 926
- 0
Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx
... 5¢-ACGGCTTCTACGGATCGAAACT-3¢ for PPARc ,5¢-AAGACAGCTCCTCCTCGAAGGTT-3¢ and 5¢-TGACCAAATCCCCATTTACGC-3¢ for aP2,5¢-ATCCATGGATGGACGGTAACG-3¢ and 5¢-CTGGATCCCAATACTTCGACCA-3¢ for LPL, 5¢-TGGGTTGGCTGCTTGTG-3¢ ... 5¢-GCGTGGGCAGGATGAAG-3¢for SCD, 5¢-GATGTGGAACCCATAACTGGATTCAC-3¢and 5¢-GGTCCCAGTCTCATTTAGCCACAGTA-3¢ forCD36, 5¢-GCGTCGGGTAGATCCAGTT-3¢ and 5¢-CTCAGTGGGGCTTAGCTCTG-3¢ for ACC, and 5¢-AACACCCCAGCCATGTACGTAG-3¢ ... of H-PGDS TG miceHuman H-PGDS cDNA under the regulatory control of the chicken b-actin promoter and cytomegalovirus(CMV) enhancer (Fig. 1A) was microinjected into thenuclei of fertilized eggs...
- 10
- 647
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ