0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp PCC 6803 ppt

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

... Fructose 1,6-bisphosphate aldolase (FbaA)18 sTransport and binding proteins slr0559 Periplasmic binding protein of ABCtransporter for natural amino acids (NatB)10 ssll1447 Periplasmic protein, ABC-type ... fbaA were amplified by PCR, using primers5¢-ATTTCGATCATGCAGGCCG-3¢ and 5¢-GGAAGAACCGTGCATTACC-3¢, and labeled with [a- 32P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway,NJ, ... Tanaka A, Asamizu E,Nakamura Y, Miyajima N, Hirosawa M, Sugiura M,Sasamoto S et al. (1996) Sequence analysis of the gen-ome of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803. ...
  • 12
  • 395
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "LANGUAGE SYNTHESIS GENERATION OF GERMAN FROM CONCEPTUAL STRUCTURE: MT PROJECT IN A JAPANESE/GERMAN" pot

... Winograd's terminology for functional gran~nar (Winograd, 1983). In general, case schemata will be mapped into CLAUSE-RS and concept schemata are mapped into NP-R~. A CLAUSE-RS has a ... representation as an interlingua in a practical application will be investigated and demonstrated by translating titles of Japanese papers from the field of "Information Technology". This material ... to ATLAS/II's analysis. In stage i, we first examine those semantic symbols which have an attached case schema and instantiate them according to their trans- formation rules. In this...
  • 4
  • 358
  • 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

... gene organization, as well as the same intron phase, as mammalianIL-11 genes. The 204 amino acid trout IL-11 translation has a predictedsignal peptide of 26 amino acids and mature peptide of ... differ-ences in both the 5¢- and 3¢-UTR. The major differ-ences were a 26 bp insertion in the 5¢-UTR of thecDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG(31 ... The two insertions in the 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered and distinguished from each other...
  • 12
  • 511
  • 0
Báo cáo khoa học: Differential gene expression profiles of red and green forms of Perilla frutescens leading to comprehensive identification of anthocyanin biosynthetic genes doc

Báo cáo khoa học: Differential gene expression profiles of red and green forms of Perilla frutescens leading to comprehensive identification of anthocyanin biosynthetic genes doc

... (5¢-AGAAAGCTGGGTTTATTTTGGGAGATCCATAACTTTTCTCC-3¢)for the first round of PCR; and attB1 (5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3¢) and attB2 (5¢-GGGGACCACTTTGTACAAGAAAGCTGGGT-3¢) for the sec-ond round of PCR. The GATEWAY-compatible ... proanthocyanidins in the Arabidopsis seed coat [14]. Also, the AN9 gene from petunia was incapable of transporting proantho-cyanidin, although it could participate in the transport of anthocyanin [14], ... Nishiyama Y, Hirai MY, Yano M, NakajimaJ, Awazuhara M, Inoue E, Takahashi H, GoodenoweDB, Kitayama M et al. (2005) Functional genomics byintegrated analysis of metabolome and transcriptome of Arabidopsis...
  • 9
  • 438
  • 1
Báo cáo khoa học: VEGF gene expression is regulated post-transcriptionally in macrophages pdf

Báo cáo khoa học: VEGF gene expression is regulated post-transcriptionally in macrophages pdf

... Ferrara N (1999) Role of vascular endothelial growth factor in the regulation of angiogenesis. Kidney Int 56,794–814.14 Sawano A, Iwai S, Sakurai Y, Ito M, Shitara K, Naka-hata T & Shibuya ... Strata- gene) of the AUUUA-luc construct.Obtaining RNATotal RNA was obtained using RNeasy (Qiagen). Thequantity and quality of RNA were determined spectropho-tometrically at 260 and 280 nm and ... contains a 30-nt AU-rich sequence with pentamer repeats (5-AUUAUUUAUUUAUUUAUUUAUUUAUUUAUU-3¢). A control repor-ter (AUGUA-luc) was created in which AUGUA pentam-ers replaced AUUUA pentamers...
  • 14
  • 381
  • 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

... t heyare capable of mediating a response by regulating gene expression [6,7]. Analysis of Arabidopsis thaliana mutantsimpaired in either JA biosynthe sis or signalling, gave a deeper insight ... application of JA. These experiments demonstrate that individual mem-bers of the jasmonate family are involved – at least in Arabidopsis – in different signalling pathways.An Arabidopsis(jar1)mutantwithadefectinthejasmonate ... ullMJEforMQ (GCA TGCAGGGTGATAAAAATCACTTTGTA) and fullMJErev (AAGGATCCATAATATTTTTGCGAA ATC), adding rest rictio n sites for SphIand BamHI, r espectively. Th e PCR pr oduct w as cloned i ntovector...
  • 8
  • 458
  • 1
Báo cáo khoa học: Silencing the expression of mitochondrial acyl-CoA thioesterase I and acyl-CoA synthetase 4 inhibits hormone-induced steroidogenesis potx

Báo cáo khoa học: Silencing the expression of mitochondrial acyl-CoA thioesterase I and acyl-CoA synthetase 4 inhibits hormone-induced steroidogenesis potx

... University of Buenos Aires, ArgentinaSteroid hormones are synthesized in specialized steroido-genic cells in the adrenal gland, ovary, testis, placentaand brain and are essential for maintaining ... our finding that AA or 22(R)-OH-cholesterol canbypass the effect of siRNA strongly indicate thatACS4 and MTE-I act in the same signaling pathwayat a step before the rate-limiting passage of cholesterolfrom ... step in steroidogenesis [6]. Fatty acyl-CoAs bind to theacyl-CoA-binding protein, which can bind and maythereby activate PBR. This interaction favors theaccumulation of fatty acids near StAR,...
  • 11
  • 302
  • 0
Báo cáo khoa học: Hydrogen independent expression of hupSL genes in Thiocapsa roseopersicina BBS pot

Báo cáo khoa học: Hydrogen independent expression of hupSL genes in Thiocapsa roseopersicina BBS pot

... purified as a tetramer with an a 2b2structure. This tetramer forms a complex withthe HupT ⁄ HoxJ kinase in vitro [4]. The role of theN-terminal part of the kinase, containing a PASdomain, was ... the inactivation of the chromosomal rpoN gene in the expected way(data not shown). The RPON strain was unable togrow in the absence of ammonium as a nitrogensource indicating that the N2fixing ... with E-value of 5.4e-12) in its C-ter-minal domain. The HupR architecture was determinedusing the SMART database, revealing that T. roseo-persicina HupR contained a response regulator receiverdomain...
  • 10
  • 551
  • 0
Báo cáo khoa học: Differential gene expression in periportal and perivenous mouse hepatocytes potx

Báo cáo khoa học: Differential gene expression in periportal and perivenous mouse hepatocytes potx

... alcohols1.1.1.14sugars4.1.1.32allostericactivation+2.7.1.2 fructose- 1,6-bis-P2.7.1.11oxaloacetateglucose-6-P2.7.1.40citrate2.3.3.8oxaloacetate citrate A 1.1.1.41glutamineammoniaglutamateamino aciddegradationRhbgSlc 1A4 Slc 1A2 6.3.1.2ureacycle2.6.1.13ornithineammoniaDurocanateN-formimino-glutamatehistidineN-methyl-histaminehistamineglutamate2.1.2.54.3.1.34.2.1.492.1.1.8serineglycinepyruvateCexcretionoxaloacetategluconeogenesis4.3.1.171.4.4.24.1.1.324.3.1.19cholesterolcitrateacetyl-CoA1.14.13.17bile ... of histidine catabolism, namely histidine ammonia lyase,urocanate hydratase, glutamate formiminotransferaseand histamine-N-methyltransferase, are preferentiallyexpressed in periportal hepatocytes. ... gluconeogenesis, fattyacid degradation, cholesterol and bile acid metabolism, amino acid degra-dation and ammonia utilization. In addition, several enzymes of phase Iand phase II of xenobiotic...
  • 11
  • 433
  • 0
Báo cáo khoa học: Hypoxia induces expression of a GPI-anchorless splice variant of the prion protein potx

Báo cáo khoa học: Hypoxia induces expression of a GPI-anchorless splice variant of the prion protein potx

... Kikuchi Y, Kakeya T, Yamazaki T, Takekida K,Nakamura N, Matsuda H, Takatori K, Tanimura A, Tanamoto K & Sawada J (2002) G1-dependent prionprotein expression in human glioblastoma cell lineT98G. ... preseni-lin–2 splice variant in human Alzheimer’s disease braintissue. J Neurochem 72, 2498–2505.29 Matsuzaki S, Manabe T, Katayama T, Nishikawa A, Yanagita T, Okuda H, Yasuda Y, Miyata S, Meshit-suka ... phenotypic anal-ysis of 300 subjects. Ann Neurol 46, 224–233.3 Kikuchi Y, Kakeya T, Sakai A, Takatori K, NakamuraN, Matsuda H, Yamazaki T, Tanamoto K & Sawada J(2004) Propagation of a protease-resistant...
  • 12
  • 447
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP