Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E) PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E) PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 (kid ... Change GCC–GGC in A5 5 (kid A5 5G) PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G) PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G) PT69...
Ngày tải lên : 16/03/2014, 03:20
  • 14
  • 477
  • 0
Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... a method of re-estimating the population probabilities of the types in the sample as well as estimating the probability mass of unseen types. There is also work on the estimation of the theoretical ... kyo@rd.nacsis.ac.jp Abstract In this paper I will report the result of a quan- titative analysis of the dynamics of the con- stituent elements of...
Ngày tải lên : 20/02/2014, 18:20
  • 7
  • 593
  • 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 Silvia Villamarı ´ n 1, *, Sylvia Mansilla 1, *, Neus Ferrer-Miralles 1 , Waldemar Priebe 2 and ... drug accumulated in the cells. Despite the slow uptake rate, the antiproliferative capacity of WP631 (measured as IC 50 after a 72-h continuous treatment) was greater than that...
Ngày tải lên : 20/02/2014, 23:20
  • 7
  • 581
  • 0
Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... specifying an antenna performing a specific function. (a transmit antenna). (1) Request antenna shipped by fastest available means. (2) Transmit antenna shipped by fastest available means. The ... PHRASES We can recognize the sources of text compression by two means: (1) comparing a full grammar of the standard language to that of the domain in which we are w...
Ngày tải lên : 08/03/2014, 18:20
  • 4
  • 515
  • 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... and then treated with deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan). Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis ... on the acegene microarray database (DNA Chip Research Inc. and Hitachi Software Co., Yokohama, Japan). The sig- nificance of GO term appearance in the up- and down- regulated gene...
Ngày tải lên : 30/03/2014, 04:20
  • 14
  • 597
  • 0
Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

... employ machine learn- ing techniques to automatically catego- rize the gender of each speaker given only the transcript of his/her speech, achiev- ing 92% accuracy. An analysis of the most characteristic ... can help improve the performance of a number of natural language processing tasks, such as text classification, machine translation or automatic speech recognition b...
Ngày tải lên : 31/03/2014, 03:20
  • 8
  • 347
  • 0
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

... probability over a range of possible parameters, and per- mits the use of priors favoring the sparse distributions that are typical of natural lan- guage. Our model has the structure of a standard ... for the hidden vari- ables in the model are then chosen based on the learned parameterization. Here, we propose a dif- ferent approach based on Bayesian statistical pri...
Ngày tải lên : 20/02/2014, 12:20
  • 8
  • 523
  • 0
Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

... as well as model the adjacent output labels. The additional features we 167 introduced are: • the distance to the next same word and the next same POS tag. • a binary feature to indicate if there ... features: • All the bigrams and trigrams of words and POS tags in the candidate sentence. • Bigrams and trigrams of words and POS tags in the original sentence in combinatio...
Ngày tải lên : 07/03/2014, 18:20
  • 5
  • 425
  • 1
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

... clearance and further metabo- lism of the allergen was altered as a result of the inflammation in the lungs of sensitized animals. Up to now there are few data available on the fate of an allergen after ... instillation of [ 75 Se]Der p 2 instead of the last aerosol challenge at day 30. Analysis of BAL fluid from mice instilled with nonlabelled Der p 2 at day 30 disp...
Ngày tải lên : 07/03/2014, 21:20
  • 12
  • 518
  • 0

Xem thêm

Từ khóa: