Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modiﬁes the expression level of a limited number of proteins in Escherichia coli doc

... B=MICBÞ=nwhere A and B are the MICs of drug A and drug B in the combination, MIC A and MICBare the MICs of drug A and drug B alone, FIC A and FICBare the FICs of drug A and drug B and n is the number of ... level of a limited number of proteins in Escherichia coli Ludovica Marcellini1, Marina Borro1, Giovanna Gentile1, Andrea C. Rinaldi2, Lorenzo Stella3,Pierpaolo Aimola4, Donatella ... on the mode of action of amphibian antimicrobial peptides have mainly addressedtheir interaction with phospholipid bilayers, but somehave also dealt with intact microbes, and revealed that these...

Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversiﬁcation of b-toxins ppt

... both a- and b-toxinsfor binding to rat brain synaptosomes and with excitatoryanti-insect selective toxins in insect neuronal membranes.We show that Lqhb1 a ects insect and mammalian NaChsubtypes ... channels (NaCh) are polypeptides of 6 1–7 6 aminoacids long that traditionally are divided between twomajor classes, a and b, according to their physiologicaleffects on channel gating and their ... (Aah2) and b- (Css2) anti-mammalian toxins for binding to rat brainsynaptosomes [23]. As AahIT4 shares little sequencesimilarity with any of the known anti-mammalian scorpiontoxins [1,12], and...

Tài liệu Báo cáo khoa học: Puriﬁed RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

... cellular retinaldehyde-binding protein. After 2 h of incuba-tion at 37 °C in the dark, the generated retinoids wereextracted with 300 lL of methanol and 300 lL of hexane and analyzed by normal-phase ... membraneOlga Nikolaeva, Yusuke Takahashi, Gennadiy Moiseyev and Jian-xing MaDepartments of Cell Biology and Medicine Endocrinology, Harold Hamm Oklahoma Diabetes Center, University of Oklahoma ... 541 4–5 418.36 Bok D, Ruiz A, Yaron O, Jahng WJ, Ray A, Xue L &Rando RR (2003) Puriﬁcation and characterization of a transmembrane domain-deleted form of lecithin retinolacyltransferase....

Báo cáo khoa học: Neuropeptide Y, B-type natriuretic peptide, substance P and peptide YY are novel substrates of fibroblast activation protein-a pdf

... gastrointestinal hormone peptides testedcontain a proline at P1, which may be a cause of the poor FAP cleavage of these peptides (all had a half-life of greater than 15 h). These new data on natural ... being cleaved off with a half-life of 60 min. Cleavage resulted in a predominantpeak of 4047 Da. Intact NPY had an average observedmolecular mass of 4265 Da. NPY was an efﬁcient sub-strate of ... MS analyses of VIP and glucagon incubation with FAP and DPP4.Fig. S2. Representative MALDI-TOF MS analyses of PACAP and oxyntomodulin incubation with FAP and DPP4.Fig. S3. Representative MALDI-TOF...

Báo cáo khoa học: 2-Amino-nonyl-6-methoxyl-tetralin muriate activity against Candida albicans augments endogenous reactive oxygen species production – a microarray analysis study doc

... CCAACCCTAATCTGTCG177CBP3 F: TAATGCCAATGAGAATGR: TCAGGAGGCACAAACT132COR1 F: AACAACAACACCGTCATR: TTGGCAAAGTATCGTCT160RIP1 F: CGGTCAAGGAAGCAGAAR: TTGGCAAAGTATCGTCT110CYT1 F: GCTATGGCTGAAGAATR: CTGGGAAGTAAGGGTT280QCR8 ... GTGCCTTTATTGCTGATR: AGATTCTGGGTCGTTTG182GPX1 F: TGAAAGGGAAAGTTGTCR: TCCAAGACTGGGAATGT217GPX2 F: ACTCCACAATACAAAGGTTR: AATACGGGGAAAGTCAC164SOD5 F: ACATTGGCGGTTTATCR: ATTACCTTGAGGAGCA185CDC19 ... CTGCTGCTTACGAACAR: AATGGGTAGACACCTCTG163HXK2 F: CGGTTACTATTTGGGAGAR: TTGGATGGATAAGAGGC132PFK1 F: AGTTGGCGGTGGTAATR: TTCGTAAACGGCATAA142PFK2 F: AGAAACCTGCCTCCTCAR: CCAACCCTAATCTGTCG177CBP3...

Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite speciﬁcity with a strong preference for small polar side chains docx

... mutant mesotrypsinwas inhibited by wild-type a1 AT in a manner that wascomparable with inhibition of cationic and anionictrypsins, demonstrating that Arg198 is the criticaldeterminant of resistance ... against inhibitor concentration and the equival-ence point was determined from the y-intercept of the extrapolation of the linear portion of the titration curve. The SI was then calculated as the inhibitor ... formedcomplexes. Partial proteolysis of the complexes wasalso observed, which resulted in bands migratingbetween the free a1 AT and the intact serpin–proteasecomplex. Mutating Arg122 to Ala (R12 2A) in cationicand...

Tài liệu Báo cáo khoa học: Multifunctional host defense peptides: Antimicrobial peptides, the small yet big players in innate and adaptive immunity docx

... [102].Patients with rosacea have abnormal in ammation and vascular reactivity in facial skin. These individualshave high levels of cathelicidin and higher levels of the enzyme that processes the propeptide ... well as in epithelial cellmigration, further suggesting a function for hBD2 in healing and protection of the intestinal epithelialbarrier [70].Proinﬂammatory and anti -in ammatory signals of antimicrobial ... K, Shirakata Y, KomatsuzawaH, Ouhara K, Hanakawa Y, Yahata Y, Dai X,Tohyama M, Nagai H et al. (2005) Induction of keratinocyte migration via transactivation of the epidermal growth factor receptor...

Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

... points after the AG1478 addition and analyzed forcaspase 3 activity by using a fluorometric substrate-based assay.Each point is the mean of triplicate samples, and the bar represents the standard ... indicated timepoints after the AG1478 addition and analyzed for caspase 3 activ-ity by using a fluorometric substrate-based assay. Each point is the mean of the triplicate samples, and the bar ... Ras-MAPK pathway and PtdIns3K ⁄ Akt pathway, as a consequence of inactiva-tion of EGFR [1 0–1 3]. The PtdIns3K ⁄ Akt pathway isdownregulated in response to gefitinib only in NSCLCcell lines that are...

Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

... 5¢-TCTCTGCTGCCAGACA-3¢ and 5¢-GCCACAGCAGAACAGA-3¢ forHVEM; 5¢-TCCTTCACCGATGGCACTATCC-3¢ and 5¢-TCAACACCAGCAGGATGCTC-3¢ for nectin-1; and 5¢-AGAAGCAGCAGCACCAGCAG-3¢ and 5¢-GTCACGTTCAGCCAGGA-3¢ for nectin-2. ... that F-actincytoskeletal changes may be related to enhanced and more productive viral infection, and the interaction of the virus with nectin-1 may play a critical role in regu-lating the actin ... cytoskeleton that may occur during the initial 6 h window of infection.We infected RPE cells with K26GFP [27], and stainedcells for F-actin, using phalloidin at 30 min and 6 hpostinfection, and examined...

Tài liệu Báo cáo khoa học:Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacyy docx

... GAACATATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAAAGTGCAACCAATCTG. The annealing s ite f or the upstream primer corresponds to 12 amino acids before the protease sequence. These ... [9], amprenavir [10], lopinavir [11] and atazanavir [12]),there is an urgent need for improved drugs against HIVprotease because of increasing viral resistance and unfavor-able pharmacokinetic ... dipole–dipole interaction range of the partiallycharged C f carbon of the arginines. The presence of anelectrostatic interaction is supported by quantum mechan-ical calculat ions of the partial charges...

Xem thêm