0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: A structural overview of the PDI family of proteins docx

Báo cáo khoa học: A structural overview of the PDI family of proteins docx

Báo cáo khoa học: A structural overview of the PDI family of proteins docx

... reveals interac-tion between ERp57 and the tip of the calreticulinP-domain. Proc Natl Acad Sci USA 99, 1954–1959.53 Satoh M, Shimada A, Keino H, Kashiwai A, Nagai N,Saga S & Hosokawa M ... domainarrangement, but share the common structural feature of having at least one domain with a thioredoxin-like structural fold, babababba. Most PDI family memberscontain both catalytic and non-catalytic thioredoxin-like ... the orientation of the bb¢domains and significant differences in orientation of their a and a domains. The catalytic cysteines (orange) of the 4 °C yeast PDI structure face each other. (B) The...
  • 13
  • 483
  • 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

... strain carried the deletion of the chromosomal atp2 operon and severalcopies of a plasmid carrying the mutated atp2 operon. As a control, a parallel at p2-deleted strain w as created, in which the ... [34]) as a standard. The amounts of chromatophoresand standard protein in the different lanes of a single gelwere kept in the linear range of the luminol assay response.Light-induced ATP synthesisLight-driven ... shieldedagainst actinic light by a copper sulfate solution. The amount of sy nthetized ATP w as evaluated by a dding10–25 nMstandard ATP.ATP synthesis induced by acid-base transitionsAcid-base...
  • 9
  • 580
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

... probabilityover a range of possible parameters, and per-mits the use of priors favoring the sparsedistributions that are typical of natural lan-guage. Our model has the structure of a standard ... for the hidden vari-ables in the model are then chosen based on the learned parameterization. Here, we propose a dif-ferent approach based on Bayesian statistical prin-ciples: rather than searching ... weachieve average tagging accuracy of 86.8%. Thisfar surpasses the MLHMM performance of 74.5%,and is closer to the 90.1% accuracy of CRF/CE on the same data set using oracle parameter selection.The...
  • 8
  • 523
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

... of matrix sparse-ness can be minimized by reducing the dimension-ality of the matrix. An appropriate algebraic method that has the capability to reduce the dimen-sionality of a rectangular ... our attention to the various species of ani-mals that are among the top 30 associations to poach. Some of them seem more often affected by cooking (pheasant, chicken, salmon), others by poaching ... simple task. We decided to use the hierarchical clustering algorithm readily available in the MATLAB (MATrix LABoratory) programming language. After some testing with various similarity functions...
  • 4
  • 536
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation of high molecular mass ... shows the absence of mature OmcA (83 kDa) and OmcB(78 kDa) in an omcA–and an omcB–background,respectively, a complete lack of both proteins in the omcA–omcB–double mutant, and approximately ... between the MR-1R values and the sum of the values of the omcA–and the omcB–mutants revealed that there is no statis-tically significant difference (P ¼ 0.43).Whole cell kinetics of OmcA- andOmcB-dependent...
  • 11
  • 731
  • 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... underline).Name Size (nt) SequenceCLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE 61 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢GCE...
  • 16
  • 397
  • 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... template and the primersRRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGAAGAAAAATAATGAAC-3¢, SacI site underlined) andTorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGCTTGATGTAATC-3¢, BamHI site underlined). The ... (5¢-ACGCGGATCCAGTCATAAACAGCGGTTGC-3¢, Bam HI site un derlined),87SufI-BamHI-rv (5 ¢-ACGCGGATCCAACATCGTCGCCCTTCCA-3¢, BamHI site underlined) and SufIHA-XbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCATAGTCAGGAACATCGTATGGGTAGCCGCCTGGCGGTACCGGATTGACCAAC- ... post-translational folding [31,32]. Strik-ingly, in the absence of DnaK/DnaJ a s mall s ubpopulation of pre-SufI accumulated, an effect that was augmented in the a bsence of TF (Fig . 4A) . The relatively...
  • 9
  • 393
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

... as well as model the adjacent output labels. The additional features we167introduced are:• the distance to the next same word and the nextsame POS tag.• a binary feature to indicate if there ... features:• All the bigrams and trigrams of words and POStags in the candidate sentence.• Bigrams and trigrams of words and POS tags in the original sentence in combination with theirbinary labels ... of the candidate sentence with that of the first ranked candidate. This is because we tryto avoid a very large or small compression ra-tio, and the first candidate is generally a goodcandidate...
  • 5
  • 425
  • 1
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

... clearance and further metabo-lism of the allergen was altered as a result of the inflammation in the lungs of sensitized animals.Up to now there are few data available on the fate of an allergen after ... tracking after intratracheal(i.t.) administration of an airborne allergen relevantfor human allergic disease. The fate of Der p 2 wasfollowed both at the whole-body level by autoradio-graphy ... instillation of [75Se]Der p 2 instead of the last aerosol challenge atday 30. Analysis of BAL fluid from mice instilled withnonlabelled Der p 2 at day 30 displayed an airwayinflammation 18 h after...
  • 12
  • 518
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

... comparisons. Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix. An appropriate alge-braic method that has the capability to reduce the ... words as one of their core tasks, and as a consequence accurate lexicons providing such information are readily available for many lan-guages. Nevertheless, deriving word classes auto-matically ... number of rows to a vocabulary appropriate for evaluation purposes. Since we are not aware of any standard vocabulary previously used in related work, we manually selected an ad hoc list of 50...
  • 4
  • 433
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ