0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

Báo cáo khoa học: Structure of FocB a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

... Journal compilation ª 2010 FEBS 3381 Structure of FocB a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli Ulrika W. Hultdin1, ... FEBS 3379preliminary data analysis of FocB, a transcription fac-tor regulating fimbrial adhesin expression in uropatho-genic Escherichia coli. Acta Crystallogr F 66, 33 7–3 41.28 Altschul SF, Gish ... Interestingly, substitution of Arg61 and Arg81 impair DNA-binding in PapB, indi-cating that these residues are critical for DNA-bindingalso in FocB [25].The DNA-recognition domain of RNA polymeraserE-factor,...
  • 14
  • 459
  • 0
Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

... Mutational analyses havealso been valuable in elucidating factors important foractivity. Table 2 lists the most informative mutations thathave been made in a range of a- conotoxins. In addition,an ... or to Asn5 (5LaaMII). TheN-terminal LaaMII was shown to have a tertiary structure similar to that of the native conotoxin and maintained theactivity for the a3 b2 subtype activity associated ... University of Queensland, Brisbane, QLD, Australia a- Conotoxins that target the neuronal nicotinic acetylcho-line receptor have a range of potential therapeutic applica-tions and are valuable probes...
  • 7
  • 492
  • 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

... crystal structure of Streptococcus agalactiae serine ⁄ threoninephosphatase (SaSTP) using a combination of single-wavelength anomalousdispersion phasing and molecular replacement. The overall structure ... for exam-ple, Arabidopsis thaliana ABI1 in which the catalyticdomain is fused to an EF-hand motif, and human STP(HsSTP), which has an additional 8 kDa a- helicaldomain at the C-terminus [3,4].The ... Rajagopal L, Clancy A & Rubens CE (2003) A eukar-yotic-type serine ⁄ threonine kinase and phosphatase in Streptococcus agalactiae reversibly phosphorylate aninorganic pyrophosphatase and...
  • 10
  • 542
  • 0
Báo cáo khoa học: Structure of coenzyme F420H2 oxidase (FprA), a di-iron flavoprotein from methanogenic Archaea catalyzing the reduction of O2 to H2O ppt

Báo cáo khoa học: Structure of coenzyme F420H2 oxidase (FprA), a di-iron flavoprotein from methanogenic Archaea catalyzing the reduction of O2 to H2O ppt

... 32 4– 330.22 Wasserfallen A, Ragettli S, Jouanneau Y & Leisinger T(1998) A family of flavoproteins in the domains Archaeaand Bacteria. Eur J Biochem 254, 32 5–3 32.23 Gomes CM, Giuffre A, ... domain (residues 1–2 52) harboring a di-iron center, and a C-terminal flavodoxin-likedomain (residues 25 3–4 04) containing FMN. Twomonomers assemble via a head-to-tail arrangement,such that the ... thuspreventing its formation.Binding of FMN and modeling of F420H2The conformation and binding characteristics of FMNare nearly identical in all of the analyzed structures of F420H2oxidase...
  • 12
  • 563
  • 0
Báo cáo khoa học: Structure ⁄function analysis of spinalin, a spine protein of Hydra nematocysts doc

Báo cáo khoa học: Structure ⁄function analysis of spinalin, a spine protein of Hydra nematocysts doc

... Golgi apparatus.During this process, the external tubule is assembled atthe apical end of the capsule and in a later stage invag-inates into the capsule matrix and spines are assembled in the ... residue.Dimer formation of spinalinAnalytical ultracentrifugation was used for a moreaccurate analysis of the oligomeric state of solublespinalin eluted in the first peak (Fig. 4A) . At low pro-tein concentrations ... process, as in the case of NOWA [6]. Here we show that spinalinalready forms large disulfide-linked aggregates during expression. As recombinant spinalin was partly mono-meric, we assume that oligomerization...
  • 8
  • 473
  • 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLUR1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAACTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢-GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTTTGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTTTGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAATGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTTAACAGATATGCCGGTTATT CCACCGGT GCC-3¢), GLUT46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCATATCTGTTAAGTTGTTC-3¢); ... H44 7A, D45 0A for-ward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTGATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A Fig. 7. Adsorption to raw starch of Glu and R1 5A, H44 7A, T46 2A, H44 7A + D45 0A mutants (A) and...
  • 11
  • 548
  • 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

... HN in the side chain. TheN-terminal Gly1 appears as a weak and very broad peak. All H a chemical shifts of residues 5–3 1 show an upfield shift compared with random-coildata indicating an a- helical ... and classification of cross-peaks asweak, medium and strong. For the calibration of theintensities of the NOE peaks, a statistical analysis of thedaN(i,i+3) signals of residues 1 1–3 0 was performed ... 40,655 3–6 558.Ó FEBS 2004 Recombinant mutant of surfactant protein C (Eur. J. Biochem. 271) 2085 Structure and potential C-terminal dimerization of a recombinantmutant of surfactant-associated...
  • 10
  • 426
  • 0
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot

Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot

... measures of hydrophobiccore formation. Proteins 43, 1–1 1.11 Murata T, Fushinobu S, Nakajima M, Asami O, SassaT, Wakagi T & Yamaguchi I (2002) Crystal structure of the liganded anti-gibberellin ... Crystal structure of an Fab fragment in complex with a menin-gococcal serosubtype antigen and a protein G domain.J Mol Biol 293, 8 1–9 1.19 Ghiara JB, Stura EA, Stanfield RL, Profy AT & WilsonIA ... for v angles of serine residues. The searcharea was set within 10 A ˚ of the centroid of heavy atoms of GA4 in the crystal structure. Other calculation parameterswere set to the default values....
  • 11
  • 565
  • 0
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

... refinementagainst a lower-resolution dataset collected at a muchless intense beamline (ESRF, BM16). Therefore, thisobservation cannot be interpreted as a result of X-ray-induced radiation damage; rather, ... flagellates (e.g.Bodo saltans), photosynthetic algae (e.g. Euglena graci-lis), and parasitic trypanosomatids [e.g. the causalagents of the tropical diseases African sleeping sickness(Trypanosoma ... was added instead of antimycin A; cyanideinhibits the cytochrome aa3oxidase of the classicrespiratory chain, but not alternative oxidase. Thus,cytochrome-dependent respiration is essential...
  • 11
  • 513
  • 0
Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

... Sunnyvale, CA, USA) using a linear gradient of 0.0 2–0 .6MNaOAc in 0 .1MNaOH at a flow rate of 2 mLÆmin)1for 100 min and 2-mL fractions werecollected and analyzed by HPAEC using pulsed ampero-metric ... up of oligosacchariderepeats. The structures of the O-polysaccharides of allknown serologically distinguishable smooth strains of P. syringae have been determined [ 3–1 2]. Aiming at solvingthe ... membrane of Gram-negative b acteria, which playsan important role in interaction of bacteria with their hosts.LPS i s c omposed of lipid A, a c ore oligosaccharide, and anO-polysaccharide (O-antigen)...
  • 10
  • 325
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ