0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

... Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann Ruhr-Universita¨t Bochum, Physikalische ... molecularmechanism. Nature 349, 117–127.3 Herrmann C, Martin GA and Wittinghofer A (19 95) Quantitative analysis of the complex between p21ras and the Ras -binding domain of the human Raf-1 protein ... and otherlarge GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependentmanner. Various concentrations of purified hGBP 5a ⁄ b and hGBP5ta were incubated...
  • 9
  • 462
  • 0
Báo cáo khóa học: Structural properties of the protein SV-IV potx

Báo cáo khóa học: Structural properties of the protein SV-IV potx

... Structural properties of the protein SV-IVCarlo Caporale1, Carla Caruso1, Giovanni Colonna2,3, Angelo Facchiano4, Pasquale Ferranti4 ,5 ,Gianfranco Mamone4, Gianluca Picariello4, Flavia ... cases, a mixture of the native and acetylated peptides was observed and identified by the massincrease of 42 mass units. The relative level of acetylation of a peptide was estimated on the basis ... acquired in the range 1800 50 0 m/z at a scancycle of 5 s/scan. For peptide analysis, the separation wascarried out with a linear gradient of 8–40% solvent Bover 60 min, and mass spectra were acquired...
  • 9
  • 416
  • 0
Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

... siRNAZF5 (5 -GAGGAAGCAUGAGAAACUCUU-3¢ and 5 -GAGUUUCUCAUGCUUCCUCUU-3¢) matched bases 9 45 963; and the third siRNAZF5 (5 -GGUCCUGAACUACAUGUACUU-3¢ and 5 -GUACAUGUAGUUCAGGACCUU-3¢) matched bases ... Primer software developed by V. Prutkovsky and O. Sokur of the Institute of Influenza, Ministry of Health of the Russian Federation. The first pair of primers (5 -GGCCTTCAAGGCATTAAG-3¢ ,5 -AAACAAATGGCCTGTCCG-3¢) ... siRNAs for human ZF5 mRNA were selected basedon general rules for siRNA selection [43]. The firstsiRNAZF5 5 -GGUUGAGGAUGUGAAAUUCUU-3¢ and 5 -GAAUUUCACAUCCUCAACCUU-3¢) matched bases192–210; the...
  • 15
  • 472
  • 0
Báo cáo khoa học: Adhesion properties of adhesion-regulating molecule 1 protein on endothelial cells pptx

Báo cáo khoa học: Adhesion properties of adhesion-regulating molecule 1 protein on endothelial cells pptx

... endothelial venules promotes the adhe-sion and chemotaxis of naive T lymphocytes. Proc NatlAcad Sci USA 95, 258 –263.10 Stein JV, Rot A, Luo Y, Narasimhaswamy M, NakanoH, Gunn MD, Matsuzawa A, ... Molecular cloning and characterization of the complementary DNA of an M (r) 110,000 antigenexpressed by human gastric carcinoma cells and upregu-lated by gamma-interferon. Cancer Res 54 , 3831–3836.20 ... HAPEC (human appendix endothelial cells), HOMEC (human ovarymicrovascular endothelial cells).Their general endothelial characteristics, such as the presence of von Willebrand factor, angiotensin-convertingenzyme,...
  • 12
  • 368
  • 0
Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

... Guimaraes da Costa F, Paschoal ME,Ronco LV, Carvalho MG & Pardee AB (1999) Identifi-cation of a gene encoding a human oxysterol -binding protein- homolog: a potential general molecular markerfor ... 20 05 FEBS 47 15 Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiaePenghua Wang1, Wei Duan1, Alan L. Munn2,3 and Hongyuan Yang11 ... late endosomal ⁄ prevacuolar structures. At 10 min,punctate staining diminished and vacuolar staining in-creased, and finally punctate staining was almost lostwith predominant vacuolar staining...
  • 13
  • 584
  • 0
Báo cáo khoa học: Structure analysis of the flavoredoxin from Desulfovibrio vulgaris Miyazaki F reveals key residues that discriminate the functions and properties of the flavin reductase family pdf

Báo cáo khoa học: Structure analysis of the flavoredoxin from Desulfovibrio vulgaris Miyazaki F reveals key residues that discriminate the functions and properties of the flavin reductase family pdf

... K, Iizuka M, Watanabe T, Nakagawa J,Kawasaki S & Niimura Y (2007) Synechocystis DrgA protein functioning as nitroreductase and ferricreductase is capable of catalyzing the Fenton reaction.FEBS ... 5 -ACGTGAAGGTGGACGAATCC-3¢ (20-mer). We identi-fied the flavoredoxin gene in the complementary strandupstream of the ABC transporter, and then designed a 30-mer probe DNA (5 -TCGGAGGTACCGCGCTGCACGCCCAGCTTC-3¢), ... PDBentries 22 have at least one FMN–lysine and 62 haveat least one FMN–arginine interaction. For FADproteins, from the 210 entries 9 have at least oneFAD–lysine and 55 have at least one FAD–arginineinteraction....
  • 14
  • 653
  • 0
Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

... CCAACTTATGTCCCGACTCTGCATCTGTGAAAGTCaDHODH-rev, CCGGAATTCCTTATCATCAGAGCCAATTATCa-BamHI-for, GCGGATCCCGAATGTTTCGTCCAAGTATCAAATTCAAACAGTCGCak-BamHI-for, GCGGATCCCGAATGTCAAGATCAGCAATCCATGAATATGTTTTGTGCCaDHODH-rev3, CCGGAATTCTCACTTATCATCAGAGCCAATTATTTGCTCCCATGExpression ... ATGTTTCGTCCAAGTATCAAATTCZGCaURA1–3¢, TCACTTATCATCAGAGCCCa-forlong2, ATGTTTCGTCCAAGTATCAAATTCAAACAGTCGACTTTGTCCCaKDHODH-mutfor1, CACAGATGCAGAGTCGGGACATAAGTTGGGGGTTCaKDHODH-mutrev1, CCAACTTATGTCCCGACTCTGCATCTGTGAAAGTCaDHODH-rev, ... CCGGAATTCTCACTTATCATCAGAGCCAATTATTTGCTCCCATGExpression plasmids The C. albicans URA1 gene (accession number AY2308 65) was subcloned with the oligonucleotides ZGCaURA1 5 and ZGCaURA1–3¢. The 13 35- bp...
  • 9
  • 458
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf

Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf

... Suzuki 5 and Yasushi Kawata3,41 National Institute of Advanced Industrial Science and Technology, Ikeda, Osaka, Japan2 Department of Food Science and Nutrition, Faculty of Human Life and Science, ... and catalysis. Biochemistry 48, 3417–3424.31 Nakamura T, Matsumura H, Inoue T, Kai Y, UegakiK, Hagihara Y, Ataka M & Ishikawa K (20 05) Crystallization and preliminary X-ray diffractionanalysis ... bound to the metal, in the company of a water oxygen, from the apical positions. The manga-nese was only 0.06 A ˚out of the equatorial plane(Table 3). The angles around the metal cofactor sug-gested...
  • 12
  • 762
  • 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... cannot,however, explain the remarkably broad wings of the signal. The broad lineshape and the enhanced relaxa-tion properties of the signal at 77 K indicate that the YÆ is coupled to a paramagnetic ... Brukersoftware, as described above.Analysis of metalsManganese and iron have been determined by GF-AAS and ICP-MS. [As a result of problems with the protein matrix in the analysis of metalloproteins, ... GTA GGTTGA TTT CAT GTC GAA TG-3¢; additional XbaI siteunderlined) and OB 3 (5 -AAA AGA ATT CTT AGAAGT CCC AGT CAT CGT C-3¢; additional EcoRI siteunderlined). The amplified PCR fragment (Taq...
  • 14
  • 872
  • 0
Tài liệu Báo cáo khoa học: Solution properties of full-length integrin aIIbb3 refined models suggest environment-dependent induction of alternative bent ⁄extended resting states doc

Tài liệu Báo cáo khoa học: Solution properties of full-length integrin aIIbb3 refined models suggest environment-dependent induction of alternative bent ⁄extended resting states doc

... I) and A2 bB3-eots (panels E and J), are shown as ribbons (protein only, panels A E) and as surface (protein) and space-filling (carbohydrates and OG moieties) representations (panels F–J). The a IIbb3modules ... tailseparation was in accordance with both the ET and hydrodynamic data of primed a IIbb3. Our revised mod-els further support an alternative view of the confor-mational states and mechanism of ... experimental work and feedback on our calculations of the nanodiscs proper-ties; and to A. Shih and S.G. Sligar (University of Illi-nois at Urbana-Champaign, IL, USA) for providing a nanodisc atomic...
  • 13
  • 522
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ