Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation Andrei M. Vacaru1and Jeroen den Hertog1,21 ... theseresults indicate that catalytically active RPTPa-D2 is required for binding and activation of Src. DiscussionHere we report that inactivating mutations in the membrane-distal domain of RPTPa affected ... bio-logical function of RPTPa, impairing Src binding andits ability to activate Src. Our results indicate that a catalytically active D2 domain is required for RPTP a- mediated Src binding and activation. We...
- 9
- 289
- 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt
... notmanually annotate a large portion of the MZEE cor-pus, the training data consisted of the disjoint sub-sets of the English and German CELEX wordlists(Baayen et al., 1995), as well as the ... classified separately, andif the maximum anglicism classifier score out of allsplits exceeds a target confidence c (=0.7), the orig-inal word is labeled a candidate anglicism. Parame-ter values were ... Dissemination, Diversity, and Dynamics of English Borrowingsin a German Hip Hop ForumMatt GarleyDepartment of LinguisticsUniversity of Illinois707 S Mathews AvenueUrbana, IL 61801, USAmgarley2@illinois.eduJulia...
- 5
- 537
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... GAGGCTAGATACTGCTCGATGTIL-10 forward3 TGATGATTTGGAACCATTATTGAAIL-10 reverse3 CACCTTTTTCCTTCATCTTTTCATb-Actin forward1 ACTACCTCATGAAGATCCTGb-Actin reverse1 TTGCTGATCCACATCTGCTGT7- forward TAATACGACTCACTATAGGGSP6-reverse ... characterization and expression analysis of interleukin-10from the common carp,Cyprinus carpioL.Ram Savan1, Daisuke Igawa2and Masahiro Sakai21United Graduate School of Agricultural ... mouse,rat and other mammalian counterparts [26–28]. In thepresent work we isolated and characterized a carp cDNAsequence that is homologous to the DNA sequence of mammalianIL-10.CarpIL-1 0is1 096bpinlengthandencodes...
- 8
- 584
- 0
Báo cáo khoa học: Mouse cytosolic sulfotransferase SULT2B1b interacts with cytoskeletal proteins via a proline⁄serine-rich C-terminus doc
... of a- cyano-4-hydroxycinnamic acid in acetone). Mass spectrawere obtained with an autoFLEX II TOF ⁄ TOF (BrukerDaltonics, Billerica, MA, USA), and the data were ana-lyzed by a mascot search against the SwissProt ... Science and Technology of Japan, Health and Sciences Research Grants (Toxicoge-nomics) from the Ministry of Health, Labor and Wel-fare of Japan (Y. Sakakibara), Japan Foundation for Applied ... Sakakibara, Department of Biochemistryand Applied Biosciences, University of Miyazaki, 1-1, Gakuenkibanadai-Nishi,Miyazaki, Miyazaki 889-2192, JapanFax ⁄ Tel: 81 985 58 7211E-mail: ysakaki@cc.miyazaki-u.ac.jp(Received...
- 8
- 266
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... Comparini C, Calamassi R, Pazzagli L,Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia andhyphae of Ceratocystis fimbriata f. sp. Platani. ... Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala A (1999) Purification, characterization, andamino acid sequence of cerato-platanin, a new phyto-toxic protein from Ceratocystis ... [e.g.cerato-platanin of Ceratocystis fimbriata f. sp. platani,Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and path-ogenesis-related proteins (As-CG of Coccidioides...
- 14
- 494
- 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx
... naturally occurring conopep-tide in chromatography studies. This is particularly applic-able for a- conotoxins because there are a manageablenumber of potential disulfide isomer variants. Authenticity is ... ammonium bicarbonate for disulfide formation; g, Synthesised by tBoc assembly, HF cleavage and air oxidation in ammoniumbicarbonate for disulfide formation; N /A, not available.Name Sequence Prey ... identification of post-translational modificationsIsolation and identificationStandard procedures for identification and isolation of a- conotoxins generally incorporate separations usingreversed-phase...
- 11
- 554
- 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain Naoto Ohtani1, Natsumi Saito1, Masaru Tomita1, Mitsuhiro Itaya1,2and Aya Itoh11 Institute for Advanced Biosciences, ... 88,12–19.19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004)Identification of the first archaeal type 1 RNase H genefrom Halobacterium sp. NRC-1: archaeal RNase HI cancleave an RNA-DNA junction. ... Tsuruoka, Yamagata, Japan2 Mitsubishi Kagaku Institute of Life Sciences, Machida, Tokyo, JapanIt is generally accepted that ribonuclease H (RNaseH; EC 3.1.26.4) specifically cleaves an RNA strandof...
- 10
- 561
- 1
Báo cáo khoa học: Biologically active, non membrane-anchored precursors – an overview ppt
... arelinked to diseases and used as diagnostic markers (e.g.proapoA-I is associated with Tangier’s disease, CgA is a diagnostic marker of a variety of neuroendocrine mark-ers and chronic heart failure, ... vivo. ProapoA-I has also been linked to Tang-ier disease, a disease with abnormally low levels of apoA-I and HDL. In Tangier disease, proapoA-I is present in approximately equivalent concentrationscompared ... receptor and activate an intracellularsignal transduction cascade in a manner analogous toTNF -a. Chromogranins/secretograninsThe granin family comprises another example of pre-cursors that have biological...
- 16
- 196
- 0
Báo cáo khoa học: Glycosphingolipids in Plasmodium falciparum Presence of an active glucosylceramide synthase pot
... 671–677.33. Hanada, K., Palacpac, N.M.Q., Magistrado, P .A. , Kurokawa,K., Rai, G., Sakata, D., Hara, T., Horii, T., Nishijima, M. &Mitamura, T. (2002) Plasmodium falciparum phospholipase Chydrolyzing ... of GSL biosynthesis was shown. Theparticular substrate specificity of the malarial GCS suggeststhat this enzyme might represent a new attractive target for malarial chemotherapy.Materials and ... PPMP-treated ring forms.As regards the palmitic acid labeled parasites, the sameanalysis was carried out. In accordance, when the incor-poration of palmitic acid was compared in treated andnontreated...
- 11
- 376
- 0
Báo cáo khoa học: Functionally active fusion protein of the novel composite cytokine CLC/soluble CNTF receptor pdf
... protein.This is in part explained by the fact that p35 and p40components are already covalently a ssociated through a disulfide bridge leading to a stable association.Many examples of cytokine receptors ... 1B,left panel). SDS/PAGE analysis r evealed a single banddisplaying an ap parent m olecular weight o f 85 kDa, whichwas quantified based on known concentrations of BSA runon neighboring lanes. ... Ohtani, T.,Yamanaka, Y., Nishida, K., Nakajima, K., Hibi, M. & Hirano, T.(1998) Gab1 acts as an adapter molecule linking the cytokine receptor gp130 to E RK mitogen-activated protein kinase....
- 10
- 523
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ