Báo cáo khoa học: On the aggregation properties of FMRP – a link with the FXTAS syndrome? pot

... by the concentra-tion dependence of the conformational transition.Relatively small variations of protein concentrationalso lead to an increase of the rates at which the con-formational transition ... 1921 On the aggregation properties of FMRP – a link with the FXTAS syndrome? Ljiljana Sjekloc´ a* , Kris Pauwels and Annalisa PastoreMRC National Institute for Medical Research, London, UKIntroduction The ... transmission electron microscopy andexamined samples after the conformational transitionFig. 5. Following the conformational transi-tion of FMRP Nt-KH1 at 37 °C and differentincubation times as a...

Báo cáo khoa học: Spectroscopic and kinetic properties of the horseradish peroxidase mutant T171S Evidence for selective effects on the reduced state of the enzyme potx

... P, was determined, while allowing the remaining Kdand maximum absorbance change at satura-tion (A 1) to ﬂoat.Resonance Raman and electronic absorptionspectroscopyFor resonance Raman and ... Fe-Hisbond and hence on the status of the proximal HisH-bond. It appears that one can readily rationalize the general trends but not the magnitude of the chan-ges seen.Entropy factors can in ... indicating the probable bind-ing of His42 to the haem iron, i.e. a major collapse orrearrangement of the distal cavity has taken place.Hence, the overall conclusion that may be drawn isthat modiﬁcation...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: electron transfer through the nitric oxide synthase ﬂavoprotein domain pdf

... domain has fundamen-tal structural, thermodynamic and mechanistic featuresin common with the dual-ﬂavin family of reductases,there are unique aspects related to NO synthesis thatconstrain and ... the Ca2+-binding protein calmodulin(CaM) to enable their participation in biologicalsignaling cascades. By contrast, iNOS binds CaMregardless of the Ca2+concentration and can remaincontinuously ... 50and near 100%) [63,77]. At this point, the data suggestthat Keq A and the associated k on and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity...

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

... of sipWW10 AACACACAGAATAATCGGGATCAC Cloning of sipWW11 GAGAATTCAAAAGAAAGCGGGGAAGAA Construction of pOpacWhW12 CGAGATCTTGTGGACATGGTCCCGTTTC Construction of pOpacWhS1 CGGAATTCGCTAATGGGAGGAAATCAC ... CAGCAATTGACCCTTAGGAGTTGGCAT Construction of pOpacBhLep2 GATGGATCTATGGATGCCGCCAATG Construction of pOpacBhOmp1 GCAAAGCTTATTTTGGATGATAACGAGGCG Construction of pOpacOmp2 GCGAATTCCTACCAGACGAGAACTTAAGCC ... CGGAATTCGCTAATGGGAGGAAATCAC Construction of pOpacShS2 TACAGATCTTTTCGTCTTGCGAATTTC Construction of pOpacShT1 CAGAATTCGTCTAGGAGGAACCACGTT Construction of pOpacThT2 GCGAGATCTTTTTGTCTGACGCATATC Construction of pOpacThLep1...

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... P763(5¢-TTCTCGAGACGCGTTATCGATAGAGAAATGTTCTGGC-3¢) and digested the PCR product with EcoRIand XhoI. The insert was synthesized with primers P764(5¢-AACTCGAGGCTAGTCTGCAGGAGCTCAAGCTTTCTAGAGAATTCA-3¢)andP765(5¢-TGAATTCTCTAGAAAGCTTGAGCTCCTGCAGACTAGCCTCGAGTT-3¢). ... adenylate cyclase with the exception of an artiﬁcial isoform (CRFR1h2) with the insertion of 37 amino acids between the ligand bindingdomain and the ﬁrst extracellular loop that was capable of producing ... Cellsurface-anchored extracellular domain of the TSH Receptormodulates expression as well as basal and TSH-dependent acti-vation. Paper Presented at the Annual Meeting of the AmericanThyroid Association, November...

Báo cáo khoa học: "Bilingual Hebrew-English Generation of Possessives and Partitives: Raising the Input Abstraction Level" pptx

... non-possessive relation: * Simlatah Sel ha-Sabat * dress-cs-her of the- Shabat Similarly, the possible realizations of the partitive are controlled by the feature realize-partitive-as: of ... selection of the unmarked realization option and the deter- mination of the default value of the definite feature remain difficult and vary a lot between the two languages. This case study has ... partitives a loaf of bread, a slice of cake, and general partitives: a piece/bit /of an item of X. In the syntactic structure of a partitive structure, the part is the head of the phrase...

Báo cáo khoa học: Puriﬁcation and properties of a new S-adenosyl-Lmethionine:ﬂavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... enzy-matic activity plays a fundamental role in the biosynthesis of methylated dianthramide-derivatives, the carnation phyto-alexins. However, no data are available regarding the role of this ... v/v);separation was performed isocratically, at a ﬂow rate of 1mLÆmin)1, and the volume of injected samples was 10 lL. The amounts of the residual initial phenolic substrate and the transformation ... The concentration of both the assayed compound and itsrespective transformation product was determined bycomparison of peak data with those obtained fromauthentic standards chromatographed at...

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate speciﬁcity doc

... (Stratagene, La Jolla, CA,USA). The primers used were: 5¢-TATATCATTCAGGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3¢ (forward, the mutagenesis codon underlined) and 5¢-TTAGCGTATTCTAAAAGATACAAATAATCCTGAATGATATAAAAAC-3¢ ... reaction was monitored by monitoring the decrease in A 340as a result of the enzymatic con-sumption of NADPH. The HP1287 enzyme concentrationwas calculated by measuring A 280and applying the theoretical ... bymonitoring the release of ammonia through the glutamatedehydrogenase assay [24]. Recombinant HP1287 with a concentration of 2.4 lm, was added to a mixture of 5 units of glutamate dehydrogenase,...

Báo cáo khoa học: Human anionic trypsinogen Properties of autocatalytic activation and degradation and implications in pancreatic diseases potx

... trypsin(ogen)degradation. Only in millimolar Ca2+concentrations wassigniﬁcant autoactivation detected, when the rate of auto-activation exceeded the rate of degradation. In contrast,because degradation of ... concentration dependence. The apparent half-maxi-mal stimulatory Ca2+concentration (15 lM) was compar-able to the Ca2+concentration that stabilized cationic trypsinagainst autolysis half-maximally ... strength. Analysis of the Ca2+dependence of autoactivation revealed a biphasic activation curve (Fig. 2C); a typical saturationcurve with an apparent EC50 of  15 lMwas followed bylinear concentration...

Tài liệu Báo cáo khoa học: On the mechanism of action of the antifungal agent propionate Propionyl-CoA inhibits glucose metabolism in Aspergillus nidulans doc

... bicarbon-ate increased the growth rate again, probably because itstimulated the degradation of propionyl-CoA via methyl-malonyl-CoA [12]. It was also shown that a ccumulation of Correspondence ... length of lightpath of the cuvette], which con siders the decrease of the concentration of oxaloacetate in equilibrium with L-malateduring t he formation o f NADH (the concentrations of malate and ... extract and water to a ﬁnal volume of 980 lL. The reaction was started by t he addition of 20 lL of a 100 mMATP solution (ﬁnal concentration 2 mM)and the reduction of NAD was monitored at...

Xem thêm