Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
... It also explains the gap in semantics and logical meaning, and gives a clear computaional image of what we call conceptual analysis. This grammar is used for analysis of Japanese and synthesis ... binary case relations, fits the dependency grammar very well, since both dependency and case relation are basically binary. The dependency analysis also correlates to the atomic formula adopted ... CSs: 'ELeMent', 'SET', 'N A M E' , (&apos ;A& apos; and 'x') Conceptual Relations: 'N A M E' and 'ELeMent'. dum my relations: 'ELMI...
- 7
- 373
- 0
Tài liệu Báo cáo khoa học: "Topological Dependency Trees: A Constraint-Based Account of Linear Precedence" ppt
... an ‘oblig-atory auxiliary flip’.(18) (dass)(that)MariaMariaeinen a Mannmanhathasliebenlovek¨onnencan(that) Maria was able to love a man(19) (dass) Maria hat einen Mann lieben ... behavior iscalled ‘optional auxiliary flip’.(11) (dass)(that)MariaMariaeinen a Mannmanliebenlovek¨onnencanwirdwill(that) Maria will be able to love a man(12) (dass) Maria einen Mann wird ... isdisplayed in Figure 1 where the 2 features cats and valencyIDof concern to ID trees are groupedunder table heading “Syntax”. Finally, cat and valencyIDassign a category and anR valency...
- 8
- 353
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ... complementary mutationsMousumi Banerjee1, Hemalatha Balaram2 and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics ... inenzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv ProteinChem 66, 315–372.45 Gunasekaran K, Ramakrishnan C & Balaram P (1996)Disallowed Ramachandran...
- 15
- 635
- 0
![Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc](https://media.store123doc.com/images/document/14/br/vp/small_vpv1392870032.jpg)
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... h and then cut with ClaI (C and D).DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C). The DNA was then electrotransferred ... recorded (A and C). The DNA wasthen transferred to a nylon membrane and TPP moieties covalentlyattached to the DNA were visualized using anti-TPP serum (B and D). The mitochondrial incubation with ... alkyla-tion leading to a depletion of mtDNA in intact cells(Fig. 1). Here we report the synthesis and characterizationof a novel mitochondria-targeted alkylating reagent and show that it alkylates...
- 10
- 638
- 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... calcium ions in the activation and activ-ity of the transglutaminase 3 enzyme. J Biol Chem278,23834–23841.30 Hitomi K, Presland RB, Nakayama T, Fleckman P,Dale BA & Maki M (2003) Analysis ... which all the glutamine residues weresubstituted by asparagine residues, and fused with a peptideat the N-terminus and hexahistidine at the C-terminus [15]. The DNA of each phage was isolated and ... the obtained sequences, recombinant human TGases 1, -2 and -3 and purified guinea-pig liver TGase were purchasedfrom Zedira (Darmstadt, Germany) and Sigma (St. Louis,MO, USA). For the activation...
- 11
- 645
- 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
... form an internal nucleoskeletonas well as a peripheral lamina in human cells. J Cell Sci108, 635–644.10 Jagatheesan G, Thanumalayan S, Muralikrishna B,Rangaraj N, Karande AA & Parnaik ... pro-tein that associates with nuclear matrix. DNA Cell Biol17, 849–858.24 Lee JY, Nakane Y, Koshikawa N, Nakayama K,Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein ZAN75: ... tocompartments in the interchromatin spaceMasashi Segawa1, Koko Niino1, Reiko Mineki2, Naoko Kaga2, Kimie Murayama2, Kenji Sugimoto3,Yuichi Watanabe4, Kazuhiro Furukawa1,5and...
- 12
- 400
- 0
Báo cáo khoa học: Recent insights into cerebral cavernous malformations: animal models of CCM and the human phenotype pptx
... the ABFig. 3. Narrowed arteries associated withcirculation failure in mice lacking Ccm2. The connections of the heart to the aorta, and the associated cranial portions of the dorsalaorta are ... in the vascular malformation. Between observational and genetic studies in humans and biochemical and cellularstudies at the bench lies a gap. This minireviewexplores the contributions of animal ... National Institutes ofHealth (K.J.W. and D.Y.L.), including training grantT32-GM007464 (A. C.C.), the American Heart Associa-tion (K.J.W. and D.Y.L.), the H .A. and Edna BenningFoundation, the...
- 8
- 416
- 0
Báo cáo khoa học: Disease-related mutations in cytochrome c oxidase studied in yeast and bacterial models pptx
... activity of the enzyme but they might alter itsassembly. L196I, G78S and DF94–F98 are located at the interface between subunits 1 and 3 and might weaken the assembly of these two subunits. A2 00T ... stationary phase. Based on densitometry meas-urements (see Materials and methods) G78S and A2 00T contain asmuch subunit 3 as the wild-type oxidase and DF94–F98 in lanes D and Econtains 25% of the ... compared to the same ratio for the wild-typeoxidase purified by the same method and run on the samegel. Thus, the staining intensity of subunit 2 serves as aninternal control in each lane and the...
- 9
- 318
- 0
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf
... data (different from the trainingdata)1.RerankingCandidate 1Candidate 2Candidate 3Candidate 4: Case element: VerbCandidateCandidateFigure 2: Selection of possible parses for rerankingMany ... obtained by using a Japanese depen-dency analyzer such as KNP (Kurohashi and Na-gao, 1994) or CaboCha (Kudo and Matsumoto,2002). Although this information is less accu-rate than manually annotated ... that simply adding it as a feature doesnot improve the accuracy.5.5.3 Changing the amount of training dataChanging the size of the training data set, weinvestigated whether the degree of accuracy...
- 8
- 481
- 0
Báo cáo khoa học: "ENGLISH GENERATOR FOR A CASE-LABELLED DEPENDENCY REPRESENING" pdf
... notably as a part of a free text retrieval system and as part of a natural language front end to a relational database system. i. Introduction This pa[~er describes a progrmn which has been ... from the phrasal ~,~ clausal patterns. These rules contain most of the syst~n's knowleuge about the relatzonship between the constructs of Boguraev' s representation la,~uage and ... interrelatea, each is distinct and separate. This well defzned separation greatly 194 increases t/~e extensability and maintainability of the syst~. A~ noted in the previous section the application...
- 4
- 419
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015