Báo cáo Y học: Novel ﬁsh hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identiﬁcation and localization of the mature peptide pptx

... Novel ﬁsh hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identiﬁcation and localization of the mature peptide Kaori Sawada1,2, Kazuyoshi Ukena1,2, ... Iijima, N., Matsumoto, Y. , Hosoya, M., Fujii, R., Watanabe, T., Kikuchi, K., Terao, Y. ,Yano, T., Yamamoto, T., Kawamata, Y. , Habata, Y. , Asada,M., Kitada, C., Kurokawa, T., Onda, H., Nishimura, ... peak was furtherexamined in a tandem MS analysis. The needle voltage wasoptimized at 1000 V and the cone voltage was set at 50 V.Argon was used as the collision gas and the energy was set at28...

Tài liệu Báo cáo Y học: Novel bradykinins and their precursor cDNAs from European yellow-bellied toad (Bombina variegata) skin potx

... (Thr6)-bradykinyl-IAPEIV in R. rugosa and (Val1,Thr6)-bradykinin and (Val1,Thr6)-bradykinyl-VAPAS inR. nigromaculata [13,14]. Additional structural variantssuch as phyllokinin (bradykinyl-IYsulfated) ... standardization of each synthetic peptide wasachieved by acid hydrolysis of a known gravimetric quantity of lyophilisate followed by amino acid analysis using anApplied Biosystems PTH-amino acid ... from a skin library by 3¢ -and5 ¢-RACEreactions. BVK-1 contained an open-reading frame of 97amino acids encoding a single copy of (Ala3,Thr6)-brady-kinin and similarly, the open-reading frame of...

Tài liệu Báo cáo Y học: Novel complexes of mammalian translation elongation factor eEF1AÆGDP with uncharged tRNA and aminoacyl-tRNA synthetase potx

... tRNA channeling; eukaryotic protein synthesis;BIAcore analysis.Aminoacyl-tRNA synthetase (ARS) and eEF 1A are the proteins that advance the translation elongation cycle. ARSbinds ATP, an amino ... elskaya@biosensor.kiev.uaAbbreviations: ARS, aminoacyl-tRNA synthetase;eEF 1A, eukaryotic translation elongation factor 1A (formerly EF- 1a) ;EF 1A, prokaryotic translation elongation factor 1A ... amino acid and tRNA to produce aminoacyl-tRNA. The molecules of eEF 1A bind GTP and aminoacyl-tRNA, and deliver the latter to the A site of a translatingribosome. The main steps of protein biosynthesis...

Báo cáo Y học: Novel protein phosphatases in yeast docx

... supports the proposal that Hal3acts as a negative regulatory subunit of Ppz1 and inhibits the activity of the phosphatase by binding to its C-terminalcatalytic moiety [12]. A remarkable feature of ... outlined above, it is clear that these novel phosphatases play relevant roles in the biology of the yeast (cell integrity, cell c ycle regulation, cation homeostasis,etc) and that they interact ... serine/threonine phosphatases:multiple roles and diverse regulation. Yeast 12, 1647–1675.4. Posas, F., Casamayor, A. , Morral, N. & Arin˜o, J. (1992) Mole-cular cloning and analysis of a yeast protein...

Báo cáo Y học: Novel regulatory regions found downstream of the rat B29/Ig-b gene docx

... and cytoplasmic. The cytoplasmic region of the mIg heavychain is quite short and incapable o f signal transduction;instead, Ig -a/ mb1 and the B29/Ig-b heterodimer play the main roles at the beginning ... close to the N -terminal r egion of the cytoplasmic domain. K inasesin the Src family, such as Lyn phosphorylate tyrosineresidues in ITAM and phosphorylated ITAM, recruit Sykvia the SH2 domain ... conservedin rat and humans. Of these DHS, the 0 .3-kb region with the highest enhancing activity was analyzed exclusively.MATERIALS AND METHODSCells, clones, Northern hybridization, and sequencingRat...

Báo cáo y học: "In-flight medical emergencies: time for a registry"

... passenger until the airplane lands and the passenger can be taken to anemergency room [2]. Ideally, physicians can learn about the physiological changes that occur during flight and tailor theircare ... medicalkit. ASMA periodically updates these recommendations, but the latest recommendation specifically cites the lack of industry-wide data as a problem and encourages the collection of this important ... equipment. The lack of a central registry makes it difficult to conductresearch as to the true incidence of many in-flight events.Sand and colleagues have identified the lack of standardi-zation...

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

... Rome, Italy 4. Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy 5. Department of Dental Sciences and Surgery, University of Milano, Milano, Italy 6. Department of Medical Genetic, ... after a routine hema-tological investigation and after the assessment of radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Sca n (Fig. 6) of the inferior maxillary bone. ... canal. At the end of surgery, one-week intramuscular antibiotic and antiphlogistic therapy was scheduled (cefazolin sodium 2g/day and ketoprofen lysine salt 200mg/day). Figure 1: proband’s...

Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

... receptor-mediatedsignalling antagonistMani D. Kalluri1,*, Praneel Datla2,*, Akshaya Bellary1,*, Khalander Basha1, Ashwani Sharma1,Anuradha Sharma1, Shiva Singh1, Shakti Upadhyay2 and ... TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense)Cox-25¢-ATGAGATTGTGGGAAAATTGCT- 3¢ (sense)5¢- GGTAGATCATCTCTGCC TGAGTATC - 3¢ (antisense),IL-85¢- GCCAAGGAGTGCTAAAGAACTTAG -3¢ (sense)M. D. Kalluri ... such novel molecules and taking them forward as novel anti-inﬂammatory drugs.In our current study, we synthesized a library of novel small carbohydrate-derived analogues and identi-ﬁed a novel...

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

... however,abundantly glycosylated and the apparent molecular masson SDS/PAGE has been estimated to 120±140 kDa[11,12]. Human BSSL has a unique primary structure ascompared to other mammalian lipases. ... forsecretion of rat pancreatic BSSL [15]. On the other hand,we and others have shown that t he repeats are completelydispensable for the typical functional properties of BSSL,i.e. catalytic activity, ... includinghumans, the gene is also expressed in the lactatingmammary gland and the resulting protein is a constituent of the milk [1,2]. Milk BSSL is a major reason whybreast-fed infants digest and absorb...

Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc

... Tohru Nakanishi1, Takashi Nishida1,3, Takako Hattori1, Teruko Takano-Yamamoto2 and Masaharu Takigawa1,31Department of Biochemistry and Molecular Dentistry, and 2Department of Orthodontics, ... with1mg:mL21actinase E (Kaken Pharmaceuticals, Tokyo,Japan), and the radioactivity of the material precipitatedwith cetylpyridium chloride was measured in a scintillationcounter.Statistical analysisUnless ... proteoglycan synthesis in HCS-2/8 cells and RGC cells [13]. We investigated the effects of MAP kinaseinhibitors on pathways of proliferation by analyzing DNAsynthesis, and pathways of differentiation...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui ro BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ