Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx
Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx
... relativeefficiencies. Analogously, GO and MSOX show a fairlysimilar activity o n s arcosine and N-ethylglycine. In contrast,an appreciable activity on glycine, glycine- ester a ndD-pipecolic acid was only observed ... SOX catalyses the o xidative demethylati on of sarcosine (N-methylglycine) to form glycine and formalde-hyde. Similarly, DAAO catalyses the oxidative d eamination of neutral and (with a lower ... Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli Viviana Job, Gianluca Molla, Mirella S. Pilone and Loredano PollegioniDepartment...
- 8
- 482
- 0
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... collected data. Analyses were made byVL, JP, ACF and MC, VL drafted the manuscript, and all authors contributedLindström et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... education,regular evaluation and standardization of protocols in the new EMCC organization.Author details1Karolinska Institutet, Department of Clinical Science and Education and Section of ... reform in Finland.Material and methods A retrospective observational study was conducted in the EMCC in East and Central Uusimaa, an area of southern Finland where the EMCC covers about300 000 inhabitants....
- 5
- 495
- 0
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... inten-sity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors. By the fact that the rare earth ... times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistin-guishable.[51] Additionally, preclinical data suggest ... National Laboratory for Physical Sciences at Microscale &Department of Materials Science and Engineering, Hefei 230026, China 5. Biophysics of Macromolecules, German Cancer Research Center, INF...
- 11
- 655
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... performed in the US on patient data collected using the US manufactured de-vice and analyzed using the US-based software and New York data analysis center from pa-tients in the US, Germany, and Asia ... deaths annually worldwide and is also an increasing cause of concern in the developing world [2]. In the USA alone the prevalence of CAD is estimated at 5.9% of all Cauca-sians of age 18 and ... each patient was already scheduled for the reference coronary an-giography for any indication. Coronary angiographic data was recorded digitally and on cine angiographic film and was sent back...
- 13
- 684
- 0
Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc
... Residues of the catalytic triad are indicated by an asterisk.Secondary structural elements based on knowncrystal structures of PRK are indicated by h(helix) and s (strand) and calcium bindingligands ... i.e. Cys67–Cys99 and Cys163–Cys194 (numbering of VPR from the N-terminal of theproteinase domain (see Fig. 2 or 3). The proteinase domain of VPR additionally contains Cys277 and Cys281, and Cys351 ... Miyamoto, K., Tanaka, K., Kaidzu, Y. , Imada, C.,Okami, Y. & Inamori, Y. (1996) Cloning and sequence analysis of a protease-encoding gene from the marine bacteriumAlteromonas sp. starin...
- 11
- 550
- 0
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx
... Technology and Medicine, London SW7 2AZ, UK;2Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, JapanSugar conjugation is a major pathway for the inactivation and excretion of both ... project. A wing disc cDNA library derivedfrom fifth instar B. mori C108 larvae was kindly providedby Dr Kawasaki (University of Utsunomiya, Japan). A total of 1000 clones were s elected at random and ... recombinant protein wasanalysed by metabolic labelling of i nfected insect cells atdifferent times after infection. Proteins were separated bySDS/PAGE and revealed by autoradiography (Fig. 3). Asexpected...
- 7
- 470
- 0
Báo cáo Y học: Characterization of a low redox potential laccase from the basidiomycete C30 pptx
... [15].Laccase activityThe routine assay for laccase was based on syringaldazineoxidation in 0.1Mphosphate buffer (pH 5.7) at 30 °C.2,2¢-Azinobis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) and ... enzymes arecommon in plants, fungi, insects and bacteria [1]. In plants,they may mainly play a role in lignification [4] whereas in fungi they probably play the opposite role, i.e. delignifica-tion ... characterizationDetermination of protein concentration, syringaldazineoxidation tests, native and denaturating PAGE and isoelec-tric focusing analysis were as previously described [12].Laccase activities...
- 7
- 616
- 0
Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"
... hesperidin and 600 mg naringin After remaining seated and resting for 45 min., participants completed a second self report rating scale. After 75 min., a third and final self report rating scale ... 2: Advantra Z® (50 mg of p-synephrine) Group 3: Advantra Z® with 0 mg hesperidin and 600 mg naringin Group 4: Advantra Z® with 100 mg hesperidin and 600 mg naringin Group 5: Advantra ... and anti-inflammatory agents [12, 13] as well as hepatoprotectants [14] and neuroprotectants [15]. However, the effects of naringin and hesperidin on metabolic rate and energy utilization have...
- 7
- 641
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1 -y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 ... CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3 -y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7 -y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...
- 16
- 646
- 0
Tài liệu Báo cáo Y học: Oxidation of phenols by laccase and laccase-mediator systems doc
... absorbance at 280 nm was plotted againstconcentration.Oxidations catalysed by laccase and laccase/mediatorsystems In a typical experiment, 60 lmol of substrates 1–5 wereweighedina2-mLscrew-capvialequippedwithastirringbar. ... Oxidation of phenols by laccase and laccase-mediator systemsSolubility and steric issuesFrancesca d’Acunzo, Carlo Galli and Bernardo MasciDipartimento di Chimica and Centro CNR Meccanismi ... formation of the same phenoxy radicalintermediate as laccase, yields the same products as theenzyme alone, namely, ring-opening and phenol couplingproducts, with a comparable extent of substrate...
- 6
- 539
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyendevelopment of a simple efficient and general method for cofactor recycling in a bio oxidationbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM