Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L ) pot
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot
... new S-adenosyl- L -methionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L. ) Paolo Curir1, Virginia Lanzotti2, Marcello Dolci3, Paola Dolci3, Carlo Pasini1 and Gordon Tollin41Istituto ... method of Baayen and Elgersma [13], with a 500-lLdropofFod conidialsuspension at a concentration of 9 · 106conidiaÆmL )1 ;20additional plants, inoculated with a 500-lL drop of doubledistilled ... acid,30 g L )1 sucrose, 5 lmol L )1 2,4-dichlorophenoxyaceticacid, 2 lmol L )1 3-indolylacetic acid (IAA), 0.2 lmol L )1 benzylaminopurine, 8.0 g L )1 Difco Bacto agar, pH 5.8prior to autoclaving....
- 10
- 624
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... surface of neoplastic cells [11]. Human malignantmelanoma contains 9-O-acetyl-NeuAc [8,12] and in humancolon carcinoma tissues N-glycolylneuraminic acid [10,13]as well as a2 ,6-linked sialic acids ... glycosidic linkages [5] on cell-surface glycocon-jugates, namely glycoproteins and glycolipids, or in bacter-ial polysaccharides. Sialic acids are a family of sugars,N-acetylneuraminic acid (NeuAc) ... concentrationsless than 25 mM. However, N-acetyl derivatives, namelyN-acetylglucosamine (GlcNAc), N-acetylgalactosamine(GalNAc) and N-acetyl mannosamine (ManNAc) werebetter inhibitors than their...
- 8
- 616
- 0
Báo cáo khoa học: Purification and properties of the glutathione S-transferases from the anoxia-tolerant turtle, Trachemys scripta elegans pdf
... SS, Saxena M, Ahmad H, Awasthi S, HaqueAK & Awasthi YC (199 2) Glutathione S-transferases of human lung: characterization and evaluation of the pro-tective role of the a- class isozymes against ... Doi AM, Pham RT, Hughes EM, Barber DS & Galla-gher EP (200 4) Molecular cloning and characterization of a glutathione S-transferase from largemouth bass(Micropterus salmoides) liver that ... quantification at 595 nm used a Dynatech MR-5000 microplate reader with a final well vol-ume of 310 lL.Statistical analysesKinetic constants, activation energies from Arrhenius plots, and statistical...
- 13
- 433
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... proteins. The polypeptide with anapparent molecular mass of 53 kDa appears as a double band inunboiled samples (lanes A1 and B 1). Table 1. N-Terminal sequences of the polypeptides of the purified ... experimentally (apparent molecular mass,cofactor content).Gene AF502 AF501 AF499 AF503 AF500Apparent/calculatedmolecular mass53/64.4 kDa 34/38 kDa 31/30.5 kDa 16/16.7 kDa – /43 kDaTransmembrane helices ... signals in the different titrations wasgenerally near 0.4 spinÆ(mol enzyme) )1 . Because of overlapwith radical signals around g ¼ 2, the signal was simulated(Fig. 4) and double integrated...
- 10
- 564
- 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx
... (200 0) Purification and characteri-zation of glutathione S-transferases from the Germancockroach, Blattella germanica (L. ). Pestic BiochemPhysiol 67, 36–45.8 Arruda LK, Vailes LD, Platts-Mills ... Characterization and comparison of commerically available German and American cockroach allergen extracts. Clin Exp Allergy32, 721–727.22 Tang AH & Tu C-PD (199 4) Biochemical characteriza-tion of Drosophila ... malaria vectorAnopheles gambiae. Biochem J 373, 957–963.35 Lumjuan N, McCarroll L, Prapanthadara L -A, Hemingway J & Ranson H (200 5) Elevated activity of an Epsilon class glutathione transferase...
- 11
- 426
- 0
Báo cáo khoa học: Purification and characterization of novel salt-active acharan sulfate lyase from Bacteroides stercoris HJ-15 ppt
... salt-active acharansulfate lyaseThe purified salt-active acharan sulfate lyase degradedheparin and heparan sulfate as well as acharan sulfate(Table 5). The salt-active acharan sulfate lyase was the ... heparin lyase III cleaved heparin as well asheparan sulfate, but did not cleave acharan sulfate. TheBacteroidal acharan sulfate lyase, which potently cleavedacharan sulfate as well as heparin, are ... acharan sulfate lyase was activated to 5.3-fold by salts(KCl and NaCl). The molecular weight of salt-active acha-ran sulfate lyase was 94 kDa by SDS/PAGE and gel filtra-tion. The salt-active acharan...
- 6
- 400
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc
... characterization of glutamateN-acetyltransferase involved in citrulline accumulationin wild watermelonKentaro Takahara, Kinya Akashi and Akiho YokotaGraduate School of Biological Sciences, Nara Institute ... (5¢-TCCT-CCATCAATCTGCTTCCATGGACCATC-3 ), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC- 3) and CLGAT3b(5¢-AAGGGAGAGAAACCTGACCTTGCACTTG-3 ). The5¢-RACE was performed using Marathon cDNA AmplificationKit (Clontech, Palo Alto, CA) according ... watermelon EST clone(accession number AI56335 1) was used to design fourGAT-specific primers; CLGAT 5a (5¢-GGCATCAACAT-CACAAGCAACAAGTGCAAG-3 ), CLGAT5b (5¢-TCCT-CCATCAATCTGCTTCCATGGACCATC-3 ), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC-3)...
- 12
- 649
- 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc
... GTGATCCCGATTATTCTGTGTGTT Cloning of sipWW9 GGCGATGTCATCACTTTTACACAA Cloning of sipWW10 AACACACAGAATAATCGGGATCAC Cloning of sipWW11 GAGAATTCAAAAGAAAGCGGGGAAGAA Construction of pOpacWhW12 CGAGATCTTGTGGACATGGTCCCGTTTC ... isopropyl thio-b-D-galactoside.De®nitions:SipS(ba), SipS(bj), SipT(ba), SipV(ba) and SipW(ba)arethe products of the sipS(ba), sipS(bj), sipT(ba), sipV(ba) ,and sipW(ba) genes of Bacillus amyloliquefaciens ... asdescribedinMaterialsandmethods.Fig. 6. Cell autolysis, CWBP pattern and autolysin activities of B. amyloliquefaciens and of sip(ba) mutants. (A) Sodium azide (0.05M ) was added to exponential-phase TBY-cultures...
- 12
- 595
- 0
Báo cáo khoa học: Purification and characterization of zebrafish hatching enzyme – an evolutionary aspect of the mechanism of egg envelope digestion pot
... byElopomorpha, and then branched paraphyletically toOtocephala and Euteleostei [11–14]. The cDNAcloning analysis using Japanese eel Anguilla japonicabelonging to Elopomorpha revealed that several hatch-ing ... by AmiconUltra 15 Ultracel-10K (Millipore Co., Billerica, MA, USA).Approximately 500 lL of the concentrated hatching liquidwas applied to a Superdex 75 10 ⁄ 300 GL column (GEHealthcare) in ... Carlsbad, CA, USA). BL21(DE 3) pLysE ⁄ pET3c-ZHE1 were grown in 20 mL of a LB culturesolution with 50 lgÆmL )1 of carbenicillin and 34 lgÆmL )1 of chloramphenicol at 37 °C in a shaking incubator for...
- 13
- 581
- 0
Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt
... (200 5) Molecular phylo-geny and evolution of Caricaceae based on rDNA inter-nal transcribed spacer (ITS) and chloroplast sequencedata. Mol Phyl Evol 37, 442–459.3 Badillo VM (200 0) Carica L. ... while crude babaco (Vasconcellea ·heilbornii ‘babaco ) latex revealed an equivalent orslightly higher proteolytic and lipolytic activity thanthat of papaya [22]. In a larger study, comparing ... familyCaricaceae [1]. The two economically most importantgenera of this family are the commonly grown tropicalspecies Carica papaya and the group of highland papa-yas (Vasconcellea spp .), of which...
- 12
- 525
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ