0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

Báo cáo khoa học:

Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

... Serial Combination of Rules and Statistics: A Case Study in Czech TaggingJan Hajiˇc Pavel KrbecIFALMFF UKPragueCzechiahajic,krbec @ufal.mff.cuni.czPavel KvˇetoˇnICNCFF UKPragueCzechiaPavel.Kveton@ff.cuni.czKarel ... belonging to a particular in ectionclass. For example, in Czech (as in many other in- flective languages), the nominative, the accusative and the vocative case have the same form (in sin-gular ... tags1Mainly because of the ease with which it is trained evenon large data, and also because no other publicly availabletagger was able to cope with the amount and ambiguity of the data in reasonable...
  • 8
  • 518
  • 0
Báo cáo khoa học: Identification of malic and soluble oxaloacetate decarboxylase enzymes in Enterococcus faecalis potx

Báo cáo khoa học: Identification of malic and soluble oxaloacetate decarboxylase enzymes in Enterococcus faecalis potx

... concentration in culture supernatants was deter-mined by the appearance of NADH in a reaction catalysedby MaeE. This is based on the fact that NADH levels areproportional to the remaining malate in ... indicating thatMaeE is responsible for malate metabolism in E. faecalis. Lastly, it wasdemonstrated that malate fermentation in E. faecalis is associated withcytoplasmic and extracellular alkalinization ... Role of MaeE in E. faecalis cytoplas-mic alkalinization associated with malatemetabolism. Cytoplasmic pH value varia-tions of wild-type (solid lines) and maeEmutant strain (dashed lines)...
  • 12
  • 271
  • 0
Báo cáo khoa học: The association of heavy and light chain variable domains in antibodies: implications for antigen specificity pot

Báo cáo khoa học: The association of heavy and light chain variable domains in antibodies: implications for antigen specificity pot

... The association of heavy and light chain variable domains in antibodies: implications for antigen specificityAnna Chailyan1,*, Paolo Marcatili1,* and Anna Tramontano1,21 Department of Physics, ... contains four (heavychains) or two (light chains) intrachain disulfide bonds and is composed of multiple variants of a basicdomain (two for the light and usually four for theheavy chain) assuming ... Delagrave S, Catalan J, Sweet C, Drabik G, Henry A, Rees A, Monath TP & Guirakhoo F (1999) Effects of humanization by variable domain resurfacing on theantiviral activity of a single-chain...
  • 9
  • 387
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "COMPARING TWO GRAMMAR-BASED GENERATION ALGORITHMS: A CASE STUDY" ppt

... 1: EAA's and SHDGA's Traversals of An Analysis Tree. 3. GENERALITY-WISE SUPERIORITY OF EAA OVER SHDGA The traversals by SHDGA and EAA as marked on the graph are stas. This means ... mode (backward application of chain rules) . EAA takes a unification grammar (usually Prolog- coded) and normalizes it by rewriting certain left re- cursive rules and altering the order of right-hand ... inefficiency and nondeterminism, and which EAA will handle in an efficient and deterministic manner. We also point out that only EAA allows to treat the underlying grammar in a truly multi-directional...
  • 8
  • 326
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

... Transparent combination of rule-based and data-driven approaches in a speech understanding architectureManny Rayner and Beth Ann HockeyRIACS, Mail Stop T2 7A- 2NASA Ames Research CenterMoffett ... effect a transparent combination of rule-based and data-driven approaches. The ar-chitecture has been implemented and evaluated in the context of a medium-vocabulary command and control task.1 IntroductionAs ... N-grams. The available data is used to train statisticswhich evaluate each feature's reliability as a pre-dictor of each semantic atom. When only smallamounts of data are used, most of...
  • 8
  • 461
  • 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... 4919Proteomic analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesisTiziana Alberio1, Alessandra Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia ... neu-rons of the substantia nigra pars compacta (SNpc) and depletion of striatal dopamine. Dopaminergic neuronaldeath is accompanied by the appearance of Lewybodies (LB), intracytoplasmic inclusions ... 465–478.13 Go´mez-Santos C, Ferrer I, Santidrian AF, BarrachinaM, Gil J & Ambrosio S (2003) Dopamine induces auto-phagic cell death and alpha-synuclein increase in humanneuroblastoma SH-SY5Y cells....
  • 11
  • 775
  • 0
Tài liệu Báo cáo khoa học: Abstract Integration of Metabolism and Survival PP-1 The metabolic switch in liver methionine metabolism pptx

Tài liệu Báo cáo khoa học: Abstract Integration of Metabolism and Survival PP-1 The metabolic switch in liver methionine metabolism pptx

... L-arginine/ADMA ratioincreased significantly (P < 0.05). Acute in ammation reducesthe L-arginine/ADMA ratio, which could contribute to in amma-tory injury. Taurine may offer an advantage in ... < 0.001). Vitamin A and melatonin pre-treatment and vitamin C treatment prevented 3-NT formationsignificantly. Vitamin A, vitamin C and, melatonin may offer anadvantage in that they could ... on basal levels of lymphocyte DNA damage and oxidative status, lymphocyte DNAdamage, plasma protein oxidation (PO), malondialdehyde (MDA) and total antioxidative capacity (TAC) and aluminium...
  • 291
  • 612
  • 0
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

... (5¢fi3¢)CorrespondingpeptideAS1 GGTTGCCTGAGRTGYATHTG a GCLRCICAS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATLAS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATLAS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTHanalyser.Synthesis of cDNATotal RNA was extracted using the RNeasy Mini Kit(Qiagen) according to the manufacturer’s instructions. Itwas treated with RNAase-free DNAase I (Pharmacia) ... of the bivalve Tapes japonica [3], with the so-called chlamysin of Chlamys islandica [4,5], and also with a hypotheticalsecreted protein of the nematode Caenorhabditis elegans and with putative...
  • 6
  • 737
  • 0
Tài liệu Báo cáo khoa học: Molecular evolution of shark and other vertebrate DNases I pptx

Tài liệu Báo cáo khoa học: Molecular evolution of shark and other vertebrate DNases I pptx

... subsequentexperiments.Construction of cDNAs encoding theH. japonicus and T. scylliaDNases ITotal RNA was isolated from the pancreas of each sharkusing Sepasol-RNA I (Nacalai tesque, Kyoto, Japan). The3¢-end region of the ... I and therecombinant enzyme revealed by silver-staining and activity-staining.The final DNase I preparation recover ed from the gel- filtrat ion stepwas concentrated and used for SDS/PAGE analysis. ... seas around Japan, and purified theformer’s enzyme. The expression of a series of m utantconstructs was a lso e xamined in mammalian cells,allowing several common structural and functional...
  • 8
  • 550
  • 0
Tài liệu Báo cáo khoa học: Polarized distribution of inducible nitric oxide synthase regulates activity in intestinal epithelial cells pdf

Tài liệu Báo cáo khoa học: Polarized distribution of inducible nitric oxide synthase regulates activity in intestinal epithelial cells pdf

... notresult in artificial increase of iNOS activity.Taken together these data indicate that in epithelialintestinal cells iNOS intrinsically associates withparticulate matter and intact activity can ... proinflam-matory stimuli [1]. iNOS protein is induced in a largevariety of human diseases, including intestinal disorderssuch as chronic in ammatory bowel diseases and colonadenocarcinoma [2–4]. ... and particulate frac-tions, indicating that iNOS exists as soluble and membrane associatedforms. In this study, iNOS features were investigated in human intestinalepithelial cells stimulated...
  • 10
  • 457
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM