Báo cáo khoa học: "PENS: A Machine-aided English Writing System for Chinese Users" pdf
Báo cáo khoa học: "PENS: A Machine-aided English Writing System for Chinese Users" pdf
... this translation,and therefore a Chinese -English bilingualdictionary (MRD), an English language model,and an English- Chinese word- translation model(TM) are needed. The English language model ... word/phrase levelautomatic translation with translation memorywill achieve a better solution to machine-aided English writing system [Zhou, 95].In this paper, we propose an approach tomachine aided ... propose an approach tomachine aided English writing system, whichconsists of two components: 1) a statisticalapproach to word spelling help, and 2) aninformation retrieval based approach tointelligent...
- 8
- 395
- 0
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format. Conceptually, ... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum-marization framework as well as a novel audiovis-ual presentation of art. MemeTube is designed as a ... ACL-HLT 2011 System Demonstrations, pages 32–37,Portland, Oregon, USA, 21 June 2011.c2011 Association for Computational LinguisticsMemeTube: A Sentiment-based Audiovisual System for Analyzing...
- 6
- 449
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation...
- 9
- 457
- 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. ... truncated fragments of TbPDE1were also amplified using the same protocol and pET-PDE1as template. PDE1(Arg189–Thr620) was amplified using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢...
- 11
- 566
- 0
Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt
... Abstract We will demonstrate the ModelTalker Voice Recorder (MT Voice Recorder) – an interface system that lets individuals record and bank a speech database for the creation of a synthetic ... screened for pitch, amplitude and pronuncia-tion and users are given immediate feedback on the acceptability of each recording. Users can then rerecord an unacceptable utterance. Recordings are automatically ... automatically labeled and saved and a speech database is created from these recordings. The system s intention is to make the process of recording a corpus of ut-terances relatively easy for...
- 4
- 419
- 0
Tài liệu Báo cáo khoa học: "Translating a Unification Grammar with Disjunctions into Logical Constraints" pdf
... Translating a Unification Grammar with Disjunctions into Logical Constraints Mikio Nakano and Akira Shimazu* NTT Basic Research Laboratories 3-1 Morinosato-Wakamiya, Atsugi 243-0198 Japan ... unification-based approach is that it enables us to describe grammar declaratively, making the development and amendment of grammar easy. Analysis systems that are based on unification gram- mars can ... E-mail: nakano@atom.brl.ntt.co.jp, shimazu@jaist.ac.jp Abstract This paper proposes a method for generating a logical- constraint-based internal representation from a unifica- tion grammar formalism...
- 5
- 303
- 0
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx
... not apply. Knott and Mellish [1996] provide an apt summary of the situation. Their 'test for relational phrases' is a good start, but geared towards the English language (we are ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessive relationship ... that a dedicated discourse marker lexi- con holding this kind of information can serve as a valuable resource for natural language pro- cessing. Our efforts in constructing that lexicon are...
- 5
- 528
- 0
Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx
... syntax-based approach. 1. Introduction In a large natural language processing system, such as a machine translation system (MTS), am- biguity resolution is a critical problem. Various rule-based and ... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... information. Hence, we will show how to annotate a syntax tree so that various interpretations can be characterized differently. Semantic Tagging A popular linguistic approach to annotate a...
- 8
- 412
- 0
Tài liệu Báo cáo khoa học: "At-Least-N Voting Improves Recall for Extracting Relations" pdf
... Extracting RelationsNanda KambhatlaIBM T.J. Watson Research Center1101 Kitchawan Road Rt 134Yorktown, NY 10598nanda@us.ibm.comAbstractSeveral NLP tasks are characterized byasymmetric data where ... asymmetry in the data andthe imbalance between precision and recall in theclassifiers.4 The ACE Relation Extraction TaskAutomatic Content Extraction (ACE) is an annualevaluation conducted by ... and recall for extracting relation mentions for all three languages.We also report ACE value1, the official metric usedby NIST that assigns 0% value to a system that pro-duces no output and...
- 7
- 289
- 0
Báo cáo khoa học: "Bootstrapping a Stochastic Transducer for Arabic-English Transliteration Extraction" pdf
... in (Al-Onaizan and Knight, 2002) or(AbdulJaleel and Larkey, 2003) require a large set ofsample transliterations to use for training. If such a training set is unavailable for a particular languagepair, ... fact that names aresometimes split differently in Arabic and English. The Arabic(2 words) is generally writtenas Abdallah in English, leading to partial matcheswith part of the Arabic name. ... transcription and a candidate English transliter-ation. The method requires a manual enumeration ofthe possible transliterations for each katakana sym-bol, which is unfeasible for many language...
- 8
- 389
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ