0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Chinese Segmentation with a Word-Based Perceptron Algorithm" docx

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T ... region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained after digestionFig. 3.45Ca overlay analysis ... has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals with desired morphologiesunder...
  • 12
  • 568
  • 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... orÔhemoabzymesÕ, are not as efficient a category of catalysts astheir natural hemoprotein counterparts. The hemoabzymes,which display a peroxidase activity, are characterized bykcat/Kmvalues ... hydroperoxide, following a peroxidase-like two-step oxygen-transfer mechanisminvolving a radical–cation intermediate. The best system,associating H2O2as oxidant and 3A3 –MP8 as a catalyst, inthe presence ... mass spectrometry.Preparation of monoclonal antibodiesMP8 was covalently attached to keyhole limpet hemo-cyanin (KLH) and to BSA, using glutaraldehyde as a coupling agent, in 1Mbicarbonate...
  • 7
  • 447
  • 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

... WEHD-AMC; caspase 2, VDVAD-AMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5,WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; ca-spase 8, IETD-AMC; caspase 9, LEHD-AMC; caspase 10, ... units.Caspases and inhibitorsCaspase substrates and their inhibitors were purchased fromBiomol. Ac-DEVD-AMC is a substrate for caspases 3and 7; Ac-YVAD-AMC is a substrate for caspase 1;Ac-IETD-AMC ... caspases, termed paracaspase, was identifiedin Homo sapiens using a PSI-BLASTsearch [39]. Paracaspasecould be a candidate gene for KIPase although no caspaseactivity from its product has...
  • 8
  • 442
  • 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAGReverse ompA105 5¢-GCCATGAATATCTCCAACGAGReverse ompA117 5¢-CATCCAAAATACGCCATGAATATCForward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCGReverse 5¢rpsO 5¢-GCTTCAGTACTTAGAGACForward ... 5¢-GCTTCAGTACTTAGAGACForward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACCReverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGGForward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGAForward oxyS109* 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTTReverse...
  • 10
  • 488
  • 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

... TAT ATG T Weak 3 aa2 ⁄ 4 55067 TCA ATG C Weak 58 aa3 33 39% 609296093360939GTA ATG CTGC ATG TTCC ATG GGAdequateWeakAdequate13 aa33 aa31 aa3¢ 76 49% –4¢ 56 61% 61041 GGA ATG T Adequate ... [13].PositionKozak consensus A GCC ATG GGContextATG1330 AAG ATG A AdequateATG2345 CTG ATG T WeakATG3396 CCC ATG A WeakATG4489 CTG ATG A WeakHu-K4 A. Munck et al.1722 FEBS Journal 272 (2005) ... obviousretrieval signal is missing.The human phospholipases D1 and D2 are mainlyassociated with the plasma membrane or with themembranes of intracellular organelles although theylack a transmembrane...
  • 9
  • 518
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Unsupervised Segmentation of Chinese Text by Use of Branching Entropy" pdf

... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 428–435,Sydney, July 2006.c2006 Association for Computational Linguistics428 0.5 1 1.5 2 2.5 ... 0.75 0.8 0.85 0.9 0.95 1recallprecisionBincreaseBordinaryBmax433 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 10 100 1000 10000 100000 1e+06size(KB)recallprecision434...
  • 8
  • 395
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Chinese Word Segmentation without Using Lexicon and Hand-crafted Training Data" pdf

... grouping character pairs with high value of mutual information into words. Although this strategy is very simple and has many limitations(e.g., it can only treat bi-character words), the characteristic ... absolute measure). Its drawback is it attaches to a character rather than to the location between two adjacent characters. This may cause some inconvenience if we want to unify it with mi. ... Word Segmentation without Using Lexicon and Hand-crafted Training Data Sun Maosong, Shen Dayang*, Benjamin K Tsou** State Key Laboratory of Intelligent Technology and Systems, Tsinghua University,...
  • 7
  • 396
  • 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

... Hyb-24DNY with the class A b-lactamase revealed that Asn266 of Hyb-24DNY has a similar spatial position to that of Glu166 in theclass A b-lactamase (Fig. S3). In the class A b-lactam-ase (Protein Data ... potentially possesses an advantage for biotechnological applications.X-ray crystallographic analyses of the G181D ⁄ H266N ⁄ D370Y enzyme andthe inactive S11 2A- mutant–Ald complex revealed that Ald ... of a nylon-6 byproduct-degradingenzyme from a carboxylesterase with a b-lactamase foldYasuyuki Kawashima1,*, Taku Ohki1,*, Naoki Shibata2,3,*, Yoshiki Higuchi2,3, Yoshiaki Wakitani1,Yusuke...
  • 10
  • 625
  • 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

... EMSAFluorescence quenchingResult Average Kd(nM)AAAGACATG + + 0.25 A GAGACATG ND –AAGGACATG ND –AAATACATG ––AAAGCCATG ––AAAGAGATG + + 1.5AAAGACCTG ND –AAAGACACG ND + 4AAAGACAT A ... Coralville, IA, USA). In addition, oligo-nucleotides, namely A GAGACATG (P2), AAGGACATG(P3), AAATACATG (P4), AAAGCCATG (P5), AAAGAGATG (P6), AAAGACCTG (P7), AAAGACACG(P8), and AAAGACAT A ... that A BCshifted123123456bandProbe1.00E+008AAAGAGATGAAGGACATGAAAGACCTGAAAGACATGKd=1.2 nMAAAGAGATGKd=0.29 nMAAAGACACGKd=4 nMAAAGACACGAAAGACATAAGAGACATGAAAGACATGAAAGCCATGAAATACATG8.00E+0076.00E+0074.00E+0072.00E+0070.00E+000141612108Fluoriscence340Fluoriscence340640.00...
  • 14
  • 393
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf

... or are automatictranslations (WNTR / WIKITR) – and about theirlanguage and lemma. In addition, translation rela-tions among lexical items are represented as a map-ping from source to target ... (bn:02945246n) and ETH-ICAL BANKING (bn:02854884n, from Italian).3 An API for multilingual WSDBabelNet API. BabelNet can be effectively ac-cessed and automatically embedded within applica-tions by means ... sentencesinto many languages (Navigli and Ponzetto, 2010;Lefever et al., 2011; Banea and Mihalcea, 2011),as well as the projection of monolingual knowledgeonto another language (Khapra et al., 2011).In...
  • 6
  • 400
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ