0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... Tanaka K, Kawai M, TainakaK, Imada C, Okami Y & Inamori Y (1993) Cloningand sequence of an alkaline serine protease-encodinggene from the marine bacterium Alteromonas sp. strainO-7. Gene ... of the catalytic domain are under-lined. The preregion is indicated in red, the pro-region in black, catalytic domain in blueand the C-terminal domains in violet. The assumed start of the second ... ST, Terada I, Matsuzawa H & Ohta T (1988)Nucleotide sequence of the gene for aqualysin I (a ther-mophilic alkaline serine protease) of Thermus aquaticusYT-1 and characteristics of the deduced...
  • 14
  • 523
  • 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding site. The ligand binding activity of ASP3c was furtherinvestigated using displacement of ASA, a fatty acid ... recombinant protein. Binding of ligands assessed by the intrinsictryptophan fluorescence The recombinant protein appeared therefore quite amena-ble to ligand -binding studies, as it was chemically ... CSP.EXPERIMENTAL PROCEDURESStrains and materialsEscherichia coli strain DH 5a was used for DNA subcloningand propagation of the recombinant plasmid. Pichiapastoris strain GS115 (his4) was used in the...
  • 11
  • 642
  • 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... sequence,confirming that the N-terminal Met and Ala wereindeed absent. Although cleavage of the terminal Metwas not unexpected, the loss of the alanine residue wasinitially surprising. However, the literature ... alternative pathways are avail-able, it is unlikely to play any significant role in the catabolism of the branched-chain amino acids or of methionine.Identification and mutation of residues affectingsubstrate ... transcription of Aro80target genes [14]. Therefore, potentially, ARO10 andits associated genes may be responsible for the catabo-lism of aromatic and branched-chain amino acids, aswell as...
  • 12
  • 436
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC...
  • 12
  • 772
  • 0
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... NorwayHaemerythrin proteins comprise a family of O2-carrry-ing proteins mainly found in a few phyla of marine invertebrates. Members of this family differfrom haemoglobin and haemocyanin in that they ... The amino acid sequence of hemerythrin fromSiphonosoma cumanense. Protein Seq Data Anal 3,141–147.43 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain ... (http://www.fruitfly.org/seq_tools/promoter.html) and has a probability of 0.98 (indicated by a redarrow in A) . Enlarged (T) indicates possible transcription start. Putativeribosomal binding site is enlarged in bold. The predicted terminationloop...
  • 13
  • 501
  • 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... known as a seed albumin [5], it was named PA1b for pea albumin 1b. PA1b is the result of the post-translational cleavage of the albumin proprotein PA1, also releasing a second peptide(PA 1a) . PA1b ... binding of PA1b to a proteinaceous component of a particulate fraction of S. oryzae extracts. The binding was saturable and reversible,and the binding site exhibits a high affinity for the native3741 ... Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus Fre´de´ric Gressent, Isabelle Rahioui and Yvan Rahbe´UMR 0203 INRA/INSA de...
  • 7
  • 604
  • 0
Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

... concentrations. SEM values were calculated by fitting data by a weighted linear regression using the software SigmaPlotÒ. AlabNA,L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, ... BmoAAX39866 Tni APN4AAK69605 SliAAF37559 Hpu APN2AAK58066 HviAAC36148 PinAAX39865 Tni APN3AAF01259 Pxy APN3Q11000 HviAAN75694 Har APN2AAF37560 Hpu APN3AAF99701 EpoAAD31183 Ldi APN1AAL83943 ... of trophic and toxic interactionsinvolving insects, comparative structural and func-tional data on insect aminopeptidases are lacking. In aphids, APN occurs in the apical network of lamellae,...
  • 15
  • 391
  • 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... pH 7.2, containing 0.1 m NaCl. The reaction was started by the addition of 0.2 lg enzyme. The initial rate was determined by measuring the increase in A 346, the isobestic point of the p-nitrophenol ... 2387 Characterization of a novel long-chain acyl-CoAthioesterase from Alcaligenes faecalisPuja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial ... thioesterase may be involved in thisthermal regulation, if it is able to control the ratios of saturated and unsaturated fatty acyl-CoAs in a tem-perature-dependent manner. Vmax⁄ Kmvalues for palmi-toyl-CoA...
  • 14
  • 513
  • 0
Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

... 5’-TGCCCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletionCAT1 5’-CGCGGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacementCAT2 5’-GCTCTAGAAAGTACAGTCGGCATTAT-3’ XbaI stkP replacementPRTI 5’-CAATTGACCAGCCTTGAGCA-3’ ... in vitro against a synthetic substrate RRA(pT)VA. Mutations in the invariant aspartate resi-dues implicated in the metal binding completely abolished PhpP activity.Autophosphorylated form of ... expressionUFKFP 5’-CGCGAATTCCGCAAGATATCGGATTAGGAA-3’ EcoRI stkP deletionUFKRP 5’-CGCGGATCCCTTGCCGATTTGGATCATTC-3’ BamHI stkP deletionDFKFP 5’-GCTCTAGAATCTACAAACCTAAAACAAC-3’ XbaI stkP deletionDFKRP...
  • 12
  • 466
  • 0
Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

... ourresults that argue for a membrane DPP III in insectswhen it is mainly identified as a cytosolic peptidase in mammals. Furthermore, the analysis of the orientation of the two putative transmembrane ... to a Pharmacia AKTA FPLC system(Pharmacia, Uppsala, Sweden) delivering 5 mLÆmin)1. The cartridge was then rinsed with Hepes buffer (con-taining 0.1% w/v Chaps for the solubilized sample) andproteins ... only traces of proctolin and Arg-Tyr after5 min incubation. A significant peak of tyrosine (about15 nmol) was detected and suggested a complete and rapiddegradation of the 65–70% internalized neuropeptidedespite...
  • 9
  • 357
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ