Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc

... nontreated c ring (–) and the c ring incubated at 95 °C for 5 min. The gel was stained with silver. A molecular mass stand-ard is shown.T. Meier et al. Structural evidence for a constant c11 ring ... that can be packed into the ring. These dataare fully compatible with the recent ﬁnding that the stoichiometry of the subunit III cylinder within the ATP synthase of the green algae, C. reinhardtii,isnot ... FEBS5¢-GGAGGAAATAAGCATATGGATATG-3¢ (forward),containing an NdeI site, and 5¢-CCTTTCAGGAAGCTTCCTCC-3¢ (reverse), containing a HindIII site. The PCRproduct and plasmid pt7-7 [25] were digested with thesetwo...

Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

... thioester acyl–enzymeintermediate. Biochemistry 49, 341–346.3 Fukuda A, Matsuyama S, Hara T, Nakayama J,Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine is essential for ... methicillin-sensitive strain MSSA476 (C). Asterisks in (A) are signals 2-Da smallerthan the triacylated peptides ﬁlled with saturated fatty acids.Triacylated lipoproteins in S. aureus M. Asanuma ... lipoprotein in S. aureus SA113 strainwas reported to be diacylated with two palmitic acidsrather than with different length fatty acids [11], weexamined whether SA2202 in the SA113 strain wastriacylated...

Báo cáo khóa học: FRET evidence for a conformational change in TFIIB upon TBP-DNA binding pptx

... CYIIB–TBP–promotercomplex formation in the presence of GAL4-VP16, differentrate constants were obtained: 4.26 min)1 for AdML and2.32 min)1 for AdE4, indicating that the acceleration of the complex formation ... (1.14–0.95 for AdML and 1.14–0.98 for AdE4). As the conformational change of TFIIB probablyinvolves a hinge motion of the domain linker, both the relative angle and distance between the NTD and CTDwill ... Transcriptional activators such as VP16 arebelieved to facilitate this conformational change in TFIIB,thereby promoting accelerated formation of the PIC and anincrease in mRNA synthesis. More...

Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx

... and the results interpreted accordingly.Fig. 1. Ouabain a nities to rat Na+/K+-ATPase isoforms and actualouabain or OLF concentrations. The guresummarizesthehugevari-ation in ouabain a nities ... mimic ouabainwith respect to the cascade in rat cardiac myocytes [9]. In rat renal cells [8] on the other hand, ouabaininteraction with a minor fraction of the Na+/K+-ATPasegave rise to the ... may have a sublocalization critical for the observations looking atouabain as a signal-transducer.Experiments pointing to a pivotal role of ouabain in signal-transduction In the following,...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: electron transfer through the nitric oxide synthase ﬂavoprotein domain pdf

... and a C-terminal ﬂavopro-tein or reductase domain that binds NADPH, FADand FMN. The two domains are separated by a CaM-binding motif. During catalysis, NADPH-derived electrons transfer into the ... for equilibrium A Common structural features in dual-ﬂavin enzymesmay determine their set points for Keq A. Among theseare complementary charge pairing interactions that arepresent to various extents in ... extents in the FNR–FMN subdo-main interface, including the interface in NOS (Fig. 8).Point mutations that neutralize charge pairing or intro-duce charge-repelling interactions may increase the Fig....

Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

... advice and assis-tance during the two-hybrid screen. We are grateful toNicola Minshall and Nancy Standart for the tetheringassay constructs, and to Marvin Wickens and LabibRouhana for the gifts ... However, the RRM-containing centraldomain of hRbm9 (amino acids 48–269) and aminoacids 269–350 of hRbm9 are not able to mediate the binding. These data suggest that a domain surroundingamino acid ... splicing onmRNA translation [34–36]. Rbm9, as a splicing factorinteracting with a PAP, may also participate in the translational enhancement mediated by introns.Indeed, the presence of the PAP...

Báo cáo khoa học: First evidence of catalytic mediation by phenolic compounds in the laccase-induced oxidation of lignin models ppt

... quitereasonable to argue that natural mediators may participate in the laccase-catalyzed oxidation of nonphenolic ligninsubunits in those micro-organisms that only rely on laccase for their ligninolitic ... delocalization of the negative charge of the anion onto the adjacent quinoid ring (see Fig. 2). Analogously, delocalization of the un-paired electron of the corresponding phenoxy radical onto the ... First evidence of catalytic mediation by phenolic compounds in the laccase-induced oxidation of lignin modelsFrancesca d’Acunzo and Carlo GalliDipartimento di Chimica, Universita`‘La Sapienza’,...

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate speciﬁcity doc

... 5¢-TATATCATTCAGGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3¢ (forward, the mutagenesis codon underlined) and 5¢-TTAGCGTATTCTAAAAGATACAAATAATCCTGAATGATATAAAAAC-3¢ (reverse). The pET151 HP1287 plasmidwas ... present any activity on thiamindegradation.Other enzymes involved in the thiamin pathway A comparative analysis of the thiamin biosyntheticpathway of more than 80 bacterial genomes was per-formed ... data were ﬁttedto the Michaelis–Menten equation using graphpad prism,version 5 (GraphPad Software Inc., San Diego, CA,USA), evaluating the initial rates by using the absorbancevalues at a...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... and complementary mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and...

Tài liệu Báo cáo khoa học: Structural bases for recognition of Anp32⁄LANP proteins doc

... domain up to a 60 : 1 ratio. The data were evaluatedusing the origin program package (Micro-Cal Software,Bletchley, UK).Yeast two-hybrid analysis The DNA fragment encoding the murine Anp3 2a ... (1–164 amino acids) was cloned into the pGBKT7 vec-tor (Clontech, Mountain View, CA, USA) for expression as a Gal4 DNA-binding domain fusion protein. This bait wastransformed into an AH 109 yeast ... demonstrated that Anp3 2a and Atx1colocalize in nuclear matrix-associated subnuclearstructures. The interaction was mapped onto the LRRand AXH domain of Anp32 and Atx1 respectively,and was shown...

Xem thêm