0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein Lisa Rosgaard*, Agnieszka Zygadlo, ... 5¢-GCGGAGCTCATGGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCTCAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTGGGTCGTAT-3¢ (His-tag underlined); PSAG with a C-ter-minal Strep-tag (PSI -G- StrepTerm), 5¢-GCGGAGCTCATGGCCACAAGCGCATCAGC-3¢ ... tagged PSI -G into PSIWhilst it is evident that both C-terminally and loop- tagged PSI -G can insert into the thylakoid in vivo (Figs 4 and 5), it is possible that the tags hinder assem-bly into...
  • 9
  • 422
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

... welinearize the system of Eqn (3) in the vicinity of the steadystate. We do this to investigate the stability of this state. In this way we obtain the in uence a small change in the concentration ... identify ÔnegativeÕ subgraphs, because theycan induce instability; their positive combined autoinfluencebestows them with oscillophoretic potential. The instability condition that apbe negative ... of Systems Biology, dissecting the system into various inter-acting kinetic regimes, whilst relating to molecular mecha-nisms.Various types of approach can be helpful here. Graph-theoretic...
  • 11
  • 638
  • 0
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot

Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot

... selected for the design of degenerate primers. Aligning different fibrinogen-domain containing proteins, fibrinogens, fibroleukins/techylectins, angiopoietins, ficolins and tenascins, the following consensus ... (1fi3)-b-D-glucan-binding protein, which bindto (1fi3)-b-D-glucans, e .g. curdlan or laminarin. Afterbinding of the carbohydrate to the receptor, the expression of the gene coding for the binding protein increases. ... elicitor-binding protein of different structure [61].Following a previously described approach [12], the (1fi3)-b-D-glucan-binding protein was identified biochem-ically. The binding of the linear...
  • 14
  • 299
  • 0
Báo cáo khoa học: Heavy metal ions inhibit molybdoenzyme activity by binding to the dithiolene moiety of molybdopterin in Escherichia coli pdf

Báo cáo khoa học: Heavy metal ions inhibit molybdoenzyme activity by binding to the dithiolene moiety of molybdopterin in Escherichia coli pdf

... the reaction mixture did not result in their insertion into MPT (data not shown). In addition, wetested the insertion of metal ions into MPT-containinghSO. None of the metals was inserted into ... aqua-glyceroporins (glycerol transportproteins) in bacteria, yeast and mammals [26], and itstoxicity lies in its ability to bind sulfhydryl groups of cysteine residues in proteins, thereby inactivating them.Arsenite ... Vanadate ions also mimicmost of the rapid actions of insulin in the cell [37]. In this report, we examined the in vivo and in vitro incorporation of metal ions of molybdenum, tungsten,vanadium,...
  • 12
  • 399
  • 0
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

... thatbinds the HBx protein encoded by the hepatitis B virus. Using deletionanalysis we identified the region within the hSuv3 protein, which is respon-sible for binding to HBXIP. The HBXIP binding ... (forward; incorporating EcoRI site, underlined) and GCGGGATCCGAAACCGTGAGCTGAATCTGCC(reverse, incorporating BamHI site, underlined). The result-ing fragment was cloned into pEG202 using EcoRI and BamHI. The ... fraction of truncated Suv3p, i. e. lack-ing the C-terminal HBXIP binding domain, can befound in the cytosol, the binding of HBXIP mayABFig. 5. The role of the C-terminal, HBXIP interacting,...
  • 12
  • 468
  • 0
Báo cáo khoa học: Affinity purification-mass spectrometry Powerful tools for the characterization of protein complexes ppt

Báo cáo khoa học: Affinity purification-mass spectrometry Powerful tools for the characterization of protein complexes ppt

... number of differentproteins into functional units. Many a time, when studying protein complexes rather than individual proteins, the bio-logical insight gained has been fundamental, particularly in cases ... within this diverse set of molecules, it is critical to maintain functional organiza-tion. It is becoming increasingly clear that an importantlevel of organization is provided by multi protein ... beinvolved in signaling processes related to the regulation of synaptic plasticity by binding to the adaptor protein PSD95. This protein contains several PDZ domains one of which binds to the...
  • 9
  • 415
  • 0
Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx

Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx

... functionally important. The N-terminal half of the expansins contains eight conservedcysteines with a spacing similar to that of cysteines in the chitin binding domain of wheat germ agglutinin ... binding domain, QQ, two glutamines suggested to form the N-terminus of the matureswollenin. The numbering refers to amino-acid positions in the mature protein. In (B), the invariant amino acids ... several other bands in addition to the onesoriginating from swo1, suggesting that there are other geneshaving expansin-like domains present in the T. reeseigenome in addition to swo1 (Fig. 4). The...
  • 10
  • 402
  • 0
Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

... the protein contains a number of interconnected drug bindingsites. The present investigation examines the coupling of drug binding toATP hydrolysis. Initial drug binding to the protein requires ... binding, Bmaxis the maximal binding, Bminis the minimum binding, IC50is the concentration of drug that leads to half-maximal bind-ing of radiolabel (nm), n is the Hill slope factor and L islog10[ligand ... switch from the initialhigh-affinity, inward-facing configuration to anoutward-facing, low-affinity configuration to facilitatedissociation [26]. Originally, the impetus for the switch in binding...
  • 9
  • 564
  • 0
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx

Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx

... 2003 and actinomycin C1were inhibitory to the enzymeactivity (Fig. 6A, lanes 4–7). The kinetics of inhibitionby these inhibitors was studied by including differentconcentrations of actinomycin ... (Mg2+>Mn2+)isrequired .The DNA intercalating agents actinomycin C1, ethidium bro-mide, daunorubicin and nogalamycin inhibit the DNAunwinding activity of PDH120 with K i values of 5.6, 5.2, 4.0 and ... Actinomycin C1, a polypeptide containing the properties of an antibiotic, intercalates into dsDNA and thereby inhibits nucleic acid synthesis [23]. Nogalamycin and daunorubicin are anthracycline...
  • 11
  • 573
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Insertion, Deletion, or Substitution? Normalizing Text Messages without Pre-categorization nor Supervision" docx

... data pairs containing digits,but remove the data pairs with chunks involvingthree letters or more in either the dictionary word or the variant. For the chunk alignments in the remain-ing pairs, ... pre-categorizing the nonstandard to-kens into insertion, deletion, substitution, etc. Wealso avoided the expensive and time consuming handlabeling process by automatically collecting a largeset of ... Linguistics Insertion, Deletion, or Substitution? Normalizing Text Messages withoutPre-categorization nor SupervisionFei Liu1Fuliang Weng2Bingqing Wang3Yang Liu11Computer Science Department, The...
  • 6
  • 329
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM