Báo cáo khoa học: Two types of replication protein A in seed

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... chromatin association of ATR (ataxia telangiecta- sia-mutated and Rad3-related) in vitro via ATR inter- acting protein [4,22,23]. Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1) play a ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A. thali- ana are already available [26]. We were able to obtain one T-DNA insertion lin...

Ngày tải lên : 07/03/2014, 21:20

12
588
0

Báo cáo khoa học: "TWO TYPES OF PLANNING IN LANGUAGE GENERATION" pot

... planning and realization and is characterized by a two- way communication at the realizer's decision points. The advantages are: First, it allows the separation of planning and realization ... Abstract As our understanding of natural language generation has increased, a number of tasks have been separated from realization and put together under the headi...

Ngày tải lên : 08/03/2014, 18:20

8
433
0

Báo cáo khoa học: Light-harvesting complex II protein CP29 binds to photosystem I of Chlamydomonas reinhardtii under State 2 conditions doc

... Each of these subpopulations was extracted from the total data set and treated de novo, gaining initial two- dimensional class averages and then iterative reﬁnement fol- lowed in order to obtain ... not contain phosphate and complimentary ions containing phosphate and satellite signals with the neutral loss of phosphoric acid (b and y ions marked with the asterisk). (A) Frag...

Ngày tải lên : 07/03/2014, 21:20

10
318
0

Báo cáo khoa học: by nucleotide afﬁnity cleavage: a distinct nucleotide speciﬁcity of the C-terminal ATP-binding site potx

... C-terminal nucleotide binding domain of Hsp90. Binding of Hsp90 to the commercially available and ‘lab-made’ ATP- Sepharose resins was analyzed as described in Materials and Methods. Figures are ... C-terminal nucleotide-binding domain in the absence of GA, and induced ATP-binding and the appear- ance of the speciﬁc N46 fragment (Fig. 7). Fluorescein isothiocyanate behaved...

Ngày tải lên : 08/03/2014, 02:21

8
392
0

Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

... 5¢-GGAGA AAGTCC GTCTATGGTGGTGTGCAGATGACACAG TTTTGGC-3¢; site 3A1 -600: 5¢-GCCTCTGCTCTGTA AGTGCAGGA CCGTAGAGGTCTATTACTTATG-3¢. mRNA analysis Total liver RNA was extracted by a modiﬁcation of the ... Ogino, M., Nagata, K., Miyata, M. & Yamazoe, Y. (1999) Hepatocyte nuclear factor 4-mediated activation of rat CYP 3A1 gene and its modes of modulation by apolipoprotein AI regulatory...

Ngày tải lên : 17/03/2014, 09:20

9
425
0

Báo cáo khoa học: Human papillomavirus 16 E7 protein inhibits interferon-c-mediated enhancement of keratinocyte antigen processing and T-cell lysis docx

... Queensland Diamantina Institute, Princess Alexandra Hospital, Brisbane, Qld, Australia Introduction Persistent infection of the cervical epithelium with one of a range of oncogenic human papillomaviruses (HPVs) ... dimethylase, for- ward, 5¢-GGA GGG CCC ATC AGT TTA AT-3¢; rRNA adenine dimethylase, reverse, 5¢-AAA CAA TTG CAT TGC ATA GTGC-3¢. The data were analyzed with rotor- gene 600...

Ngày tải lên : 29/03/2014, 00:20

9
352
0

Báo cáo khoa học: Kinetic deuterium isotope effects for 7-alkoxycoumarin O-dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes Rate-limiting C-H bond breaking in cytochrome P450 1A2 substrate oxidation pdf

... utilized as probes because of their spectral and ﬂuorescent properties. Among these are the coumarins [6,7] and resoruﬁns [7,8]. Coumarin and several derivatives are Keywords alkoxycoumarins; coumarins; ... coumarin have an advantage in that there is no issue with pro-chirality. However, with both d 1 7-OEt coumarin and d 2 7-OMe coumarin some perturbation can occur because of...

Ngày tải lên : 16/03/2014, 13:20

9
314
0

Báo cáo khoa học: Two different types of hepcidins from the Japanese ﬂounder Paralichthys olivaceus ppt

... in HIB containing 2% (w ⁄ v) NaCl (2HIB) at 25 °C. S. iniae (strain TUMST1 isolated from Japanese ﬂounder in Japan) and L. garvieae (strain SA8201 isolated from yellowtail S. quinqueradiata in ... (strain MZ8901 isolated from Japanese ﬂounder in Japan) was grown in HIB at 25 ° C. P. damselae ssp. piscicida (strain P97-008 isolated from yellowtail Seriola quinqueradiata in Japan)...

Ngày tải lên : 30/03/2014, 20:20

8
310
0

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein Linda ... normal enzyme. Eur J Biochem 246, 548–556. 15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Puriﬁ- cation and characterization of short-chain, medium- chain, and long-ch...

Ngày tải lên : 20/02/2014, 02:21

9
533
0

Tài liệu Báo cáo khoa học: "TWO KINDS OF METONYMY" pdf

... flights)that serve dinner" offers any constraint on the class AIRCRAFT: in other words, that being a particular type of aircraft and being used by a flight that serves dinner are correlated in ... its range. Since every flight in ATIS is on an airline, AIRLINE -OF is a total relation, and AIRLINE is its range, so a referential metonymy is clearly vacuous in...

Ngày tải lên : 20/02/2014, 21:20

8
464
1