Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf

... FEBS 1235 The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy Philippa Melamed, Yangkui Xue, Jia Fe David Poon, Qiang Wu, Huangming Xie, ... resembles a true male pregnancy, as the female deposits her eggs into an enclosed brood pouch on the ventral side of the male s abdomen. This brood pouch comprises epithelial and stoma-like tissue ... sites at either end, using the following primers:forward, 5¢-CGCGGATCCTGGTCTTTCCAAAATATTCAGGCCA-3¢ and reverse, 5¢-GTCCTCGAGGTACATCACATCTCTGAT-3¢. After digestion, the PCR-ampliﬁedfragment was...

Tài liệu Báo cáo khoa học: Glycomics-based analysis of chicken red blood cells provides insight into the selectivity of the viral agglutination assay docx

... Chandrasekaran A, Srinivasan A, Raman R, Viswana-than K, Raguram S, Tumpey TM, Sasisekharan V &Sasisekharan R (2008) Glycan topology determineshuman adaptation of avian H5N1 virus hemagglutinin.Nat ... HA from avian- and human-adapted viruses.Materials and methodsPNGase F (glycerol free) was obtained from New EnglandBiolabs (Beverly, MA, USA). Signal 2-AB Labeling Kit,sialidase -A and sialidase-S ... hemagglutinin.Nat Biotechnol 26, 107–113.10 Srinivasan A, Viswanathan K, Raman R, Chandraseka-ran A, Raguram S, Tumpey TM, Sasisekharan V &Sasisekharan R (2008) Quantitative biochemical ratio-nale...

Báo cáo khoa học: Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells ppt

... TGGGTTTTCAACTGGAGAGG 175SR-B1GAAACTGCAGCTGAGCCTCT ACCTACTTGGCTCCGGATTT 250ACAT1CTACAAGGCAGGCAGTATTGG TAAGCGTCCTGTTCATTTCGT 334DGAT1CCTGTGTTGAGGGAGTACCTG GGGCGAAACCAATGTATTTCT 328ABCA1AACAGTTTGTGGCCCTTTTG ... (bp)LDLrAGTTGGCTGCGTTAATGTGAC TTCCTCACACTGGCACTTGTA 343LRPCCCAGGTGTCTACCATCACAC GGGGTTGTAGAGTTCCAGGTC 326SR -A ATTGCCCTTTACCTCCTCGT ATGAGGTTGGCTTCCATGTC 248CD36AGATGCAGCCTCATTTCCAC TGGGTTTTCAACTGGAGAGG ... probucol into the particles enhances their uptake by humanmacrophages and increases lipid accumulation in the cellsElizabeth H. Moore1, Mariarosaria Napolitano2, Michael Avella1, Fatos Bejta1,...

Báo cáo khoa học: Submembraneous microtubule cytoskeleton: biochemical and functional interplay of TRP channels with the cytoskeleton pot

... co-localizes and stabilizesmicrotubules at the cell membrane. Confocal immunoﬂuorescence images of a F11 cell and an enlarged area reveals the accumulation oftubulin (red) at the plasma membrane ... Shinoda M, Nagamine K, Tohnai I,Ueda M & Sugiura Y (2005) Heat and mechanicalhyperalgesia in mice model of cancer pain. Pain 117,19–29.141 Prevarskaya N, Flourakis M, Bidaux G, Thebault ... cultures: role of calpain and caspasepathways. Cell Death Differ 11, 1121–1132.154 Razavi R, Chan Y, A ﬁyan FN, Liu XJ, Wan X,Yantha J, Tsui H, Tang L, Tsai S, Santamaria P et al.(2006) TRPV1+...

Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt

... maps and some featuresof the ﬁve A. thaliana chromosomesFigure 1 shows the z¢ curves for ﬁve A. thaliana chro-mosomes. As can be seen clearly, each curve has dra-matic variations, indicating ... less abundant in A. thaliana than inother plants and primarily dominate the centromereregions. Class II transposons and Basho elements areclustered in the pericentromeric domains. All in all,transposons ... nucleolar organizer and mitochondrial DNAinsertion regions based on the isochore map ofArabidopsis thalianaLing-Ling Chen1 and Feng Gao21 Laboratory for Computational Biology, Shandong...

Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

... tags1Mainly because of the ease with which it is trained evenon large data, and also because no other publicly availabletagger was able to cope with the amount and ambiguity of the data in reasonable ... hand, and in plural on the other). The casual (lexical, paradigm-external) morpho-logical ambiguity is lexically speciﬁc and hencecannot be investigated via paradigmatics.In addition to the ... 1999)(Slovenian), (Hajiˇc and Hladk a, 1997), (Hajiˇc and Hladk a, 1998) (Czech) and (Hajiˇc, 2000) (ﬁveCentral and Eastern European languages), butso far no system has reached - in the absoluteterms...

Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

... and ofbranched non-reducing terminal Ara6 motifs: Arafb1fi 2Arafa1 fi 5 (A rafb1 fi 2Arafa1 fi 3)Arafa1 fi5Arafa1. About two-thirds of the terminal b-Araf and the penultimate 2 -a- Araf serve as attachmentsites ... glycerol-based glycolipids [26]. The branchedarabinan chains of the arabinogalactan are attached to the linear galactan backbone. The arabinan consists ofan inner linear region of Araf-(1 fi 5) -a- Araf ... polymers and glycolipids. In mycobacteria and related Actinomycetales species, Araf is a compo-nent of the arabinan parts of the arabinogalactan and (lipo)arabinomannan polymers of the cell wall and...

Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"

... defined as calculated creatinineclearance less than 50 ml/minute. The parameters needed tocalculate the creatinine clearance were always available inboth the PB-U and the C-U. In addition to the ... the study. KC wasresponsible for conceiving the study, data acquisition, analysisof the data, statistical analysis and drafting of the manuscript.BC was responsible for data acquisition, analysis ... (non-interceptedpotential adverse drug events (ADE) or ADEs, being MPEs withpotential to cause, or actually causing, patient harm).Results The C-U and the PB-U each contained 80 patient-days, and a total of...

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... the noticeable exception of the a- amylase from the bacte-rium Pseudoalteromonas haloplanktis, which displaysan additional small (21 kDa) C-terminal domain hav-ing the size of a carbohydrate-binding ... genomedatabanks. Interestingly, this domain was found insome closely related bacterial species, but mainly innonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase ... enzymes, animal-type a- amylases arehomologous enzymes present in all animals and insome rare bacteria [11,12]. They are nonmodular, con-sisting of a single globular catalytic domain, with the noticeable...

Tài liệu Báo cáo khoa học: ¨ Induction of Kruppel-like factor 4 by high-density lipoproteins promotes the expression of scavenger receptor class B type I pptx

... 5¢-CCTTCA ATG ACA ACG ACA CCG-3¢ (forward) and 5¢-CCATGC GAC TTG TCA GGC T-3 ¢ (reverse); glyceraldehyde-3-phosphate dehydrogenase, 5¢-GAC ATC AAG AAGGTG GTG AAG C-3¢ (forward) and 5¢-GTC CAC CACCCT ... antibody.RNA extraction and real-time PCRTotal RNA was isolated using TrizolÒreagent (Invitrogen)in accordance with the manufacturer’s protocol. Afterextraction, 5 lg total RNA was then used as a ... Technology).Nuclear extract preparation and EMSAFor nuclear extract preparation, cells were harvested and washed twice with cold PBS. The nuclear extract was pre-pared as described previously [11]. EMSA was...

Xem thêm