Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... which increases the lysosomal concentration of partially active GC vari-ants, as demonstrated by increased cellular GC activity,an increased concentration of lysosomal GC glyco-forms and increased ... (causing anotherlysosomal storage disease) were shown to be foldingand trafﬁcking mutants [16] before this was explored as a possibility in GD. Galactose administrationincreased Q279E a- galactosidase ... tolm) and stabilize just one protein and thus are gener-ally protein and disease selective, if not speciﬁc.Many of the clinically important Fabry disease-asso-ciated a- galactosidase A variants...

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... bindingpartner (stability- or afﬁnity-based), one could divide a phage library in half and sort one half against a bindingpartner and the other half against an expression tag. A comparison of the ... constructing naı¨ve antibody libraries [15].Here, the association of the variable heavy chain (VH)withprotein A was used as a surrogate for direct stabilitymeasurements. The VHdomains in camelid ... to the labor-intensive process of generating and characterizingindividual mutant proteins, these combinatorial approachesoffer the important advantage of simultaneously generatinglibraries of protein...

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTTGACANNNNNNNNNNNNNNTGRTATAATNNNNAAGTAATAAAATATTCGGAGGAATTTTGAAATGAATAAACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-back (5¢-CTCTACATGCATTTCAACAATAGGGCCTGTC-3¢) ... (5¢-TGGTACTCGAGCAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GGAAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) anddownstream to pyk using primer pyk3 (5¢-GGAAGGATCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) ... signiﬁcantly as the PKactivity was modulated. At increased PK activity wefound an almost proportional increase in formate andacetate production and a decrease in lactate produc-Fig. 2. Modulation of...

Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

... that hasthem as their precondition. There may be multipleaction instances in the plan that introduce the sameatom canadjoin (A, u). In this case, we can freelychoose one of these instances as ... A, u.¬mustadjoin (A, u).We can then send the actions and the initial stateand goal speciﬁcations to any off -the- shelf plannerand obtain the plan in Fig. 3. The straight arrows in the picture link the ... through an example. Finally, we assess the practical efﬁciency of our approach and discussfuture work in Section 4.2 Grammaticality as planningWe start by reviewing the LTAG grammar formal-ism and...

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... model.Linear discriminant analysis (LDA).Thisstatisticalmultivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, ... greatestpart of the original data information. In the second part of our work, we focused on the biochemical information available i n infrared s pectra, andwe found that infrared spectra of resistant ... varying together. The ﬁrst linear combination is called the ﬁrst principal c ompo-nent, a nd contains almost 98% of the variance. The secondprincipal c omponent is a linear combination of wavenum-bers,...

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different ﬂanking bases preference pptx

... furtherconfirm if these variations in binding affinity werecaused by binding instability as a result of nonspecificinterference, rather than the alternation of a bindingsite, we carried out the ... AtERF4 was a repressor, an extra effector in which the activation domain of viral protein 16 was fused to the yeast GAL4 DNA binding domain (DBD) andthen coexpressed with the AtERF4 effector was ... site of 10 bp. The selectedsequences were aligned computationally and the appearance of a base at each position in a motif was presented as a percentage fre-quency of all four kinds of base. The...

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... CYP 6A2 speciﬁcsignal, the star indicates unspeciﬁc signal observed in all lanes loadedwith bacterial protein. The CYP 6A2 variants have the same apparentmolecularmassasCYP 6A2 fromD. melanogaster ... (CAGGACAGCCTGCGCAACGAG), RVR (CAGGACAGGGTGCGCAACGAG), SVR (CAGGACAGCGTGCGCAACGAG) and SLC (AGGGTATCCCTCTGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... located diametrically to the polecarrying the amino acids involved in substrate binding. As far as we know, there has been no report about structureactivity relationships in this area of the cytochrome...

Tài liệu Báo cáo khoa học: "Event Extraction as Dependency Parsing" pdf

... tokenfeatures from the ﬁrst and last token in thesepaths. We also generate combination featuresby concatenating: (a) the last token in each pathwith the sequence of dependency labels along the ... level(since this is the “sentence” from the parser’s point of view). The majority of additional features thatwe introduced take advantage of the original text as context (primarily its associated ... multiclass classiﬁerthat labels each token independently.3Since over92% of the anchor phrases in our evaluation domaincontain a single word, we simplify the task by re-ducing all multi-word anchor...

Tài liệu Báo cáo khoa học: Hepatic stimulator substance mitigates hepatic cell injury through suppression of the mitochondrial permeability transition pdf

... effect of HSS against CCCP-induced apoptosis, the activation of caspase-3 was examined using the enzymatic Caspase-Glo 3 ⁄ 7 assay. After CCCP treat-ment, caspase-3 activity increased markedly in ... characterized and the most prominent path-ways are the extrinsic and intrinsic pathways. In the intrinsic pathway (also known as the ‘mitochondrialpathway’), apoptosis results from an intracellular ... Glomax 96 Microplate Luminometer (Promega).Caspase-3⁄7 activityCaspase activity was detected by using the Caspase-Glo 3 ⁄ 7Assay Kit. Brieﬂy, the cells were seeded in a 96-well plateand incubated...

Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

... 5¢-GGAGATCTCCAGTGATATCGACCA-3¢ and 5¢-ACGGCTTCTACGGATCGAAACT-3¢ for PPARc ,5¢-AAGACAGCTCCTCCTCGAAGGTT-3¢ and 5¢-TGACCAAATCCCCATTTACGC-3¢ for aP2,5¢-ATCCATGGATGGACGGTAACG-3¢ and 5¢-CTGGATCCCAATACTTCGACCA-3¢ ... 5¢-GCGTCGGGTAGATCCAGTT-3¢ and 5¢-CTCAGTGGGGCTTAGCTCTG-3¢ for ACC, and 5¢-AACACCCCAGCCATGTACGTAG-3¢ and 5¢-TGTCAAAGAAAGGGTGTAAAACGC-3¢ for b-actin. Expression levels of the target genes were normalized to that of ... Laboratories,North Chicago, IL, USA), CT analysis was performed with a micro-CT scanner (LaTheta LCT-100; Aloka, Tokyo,Japan). Data were analyzed using latheta software (Alo-ka). The fat and muscle weights...

Xem thêm