Báo cáo khoa học: Evidence for two different electron transf

Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

... pro- pose a two- pathway electron transfer model for nitrate reductase A from Escherichia coli. Keywords: cytochrome b; electron transfer; Escherichia coli; nitrate reductase A; quinone. Nitrate can ... Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli Roger Gi...

Ngày tải lên : 07/03/2014, 15:20

8
442
0

$Tài liệu Báo cáo khoa học: Identiﬁcation of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line speciﬁcally binding to aptameric cytotoxic GT oligomers ppt$

Tài liệu Báo cáo khoa học: Identiﬁcation of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line speciﬁcally binding to aptameric cytotoxic GT oligomers ppt

... was then dried and auto- radiographed. In the UV cross-linking assay, the samples were incubated at room temperature, as described above for the EMSA assay, and then irradiated at 302 nm for ... and incubated with mAb for eEF 1A, as described in the Materials and methods. Lane 1, bacterial recombinant eEF 1A protein (R eEF 1A) ; lane 2, eEF 1A protein from total nuclea...

Ngày tải lên : 21/02/2014, 00:20

12
552
0

Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... indicates that the mechanism may be sim- ilar to that of Co 2+ . The fact that the equilibrium con- stants for the a domain are greater than those for the b domain may be a factor in explaining ... K 3a and K 4a for the a domain would have to be greater than K 2b and K 3b for the b domain, to explain the observed ﬁlling of the a domain prior to that of...

Ngày tải lên : 19/02/2014, 00:20

9
533
0

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... gctttttggcaccaaagccctcggctccatcgg Lys24 to Ala L2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to Ala G3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to Ala F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... Ala P2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to Ala L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala 2R > N R37N F gtagcgggctggattaacgcgttgaatt...

Ngày tải lên : 19/02/2014, 17:20

15
532
0

Tài liệu Báo cáo khoa học: Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies pdf

... colony forma- tion assay. Table 2 shows the percentage of G418- resistant colonies obtained by transfecting the established human tumor pancreatic carcinoma MIA PaCa 2 and the breast adenocarcinoma ... functions as a molecular switch in a large network of signaling pathways [1]. Mutations in the ras gene have been identiﬁed in about 30% of all human cancers, indicating tha...

Ngày tải lên : 21/02/2014, 00:20

9
624
0

Báo cáo khoa học: Evidence for the presence of ferritin in plant mitochondria pdf

... BAB64536) and AtFer1 and AtFer4 from A. thaliana. While it is clear that AtFer1 is a poor candidate for a mitochondrial localization, for the other proteins signiﬁcant scores were found. In particular, PSORT and IPSORT programs ... mitochondria (Table 3). The data presented in this paper strongly indicate a mitochondrial localization for ferritins in P. sativum and A...

Ngày tải lên : 16/03/2014, 18:20

8
504
0

Báo cáo khoa học: Evidence for the slow reaction of hypoxia-inducible factor prolyl hydroxylase 2 with oxygen pptx

... a metal-to-ligand charge transfer band at approximately 520 nm [27]. Substrate binding adjacent to the Fe(II) is proposed to weaken binding of the remaining coordinated water, thus enabling the ... MJ, Padmakumar R & Hausinger RP (1999) Stopped-ﬂow kinetic analysis of Escherichia coli taurine ⁄ alpha-ketoglutarate dioxygenase: interactions with alpha-ketoglutarate, taurine...

Ngày tải lên : 23/03/2014, 03:20

11
457
0

Tài liệu Báo cáo khoa học: Identiﬁcation of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... mutagenesis data therefore provide additional critical infor- mation over that obtained from X-ray data alone. The knowledge gained from these mutagenesis data will be valuable in directing the ... and ACE2. The zinc prote- ase domain of both tACE and ACE2 is divided into two subdomains [20]. Subdomain I contains the zinc ion and the N-terminus. The C-terminus is found...

Ngày tải lên : 20/02/2014, 01:20

9
789
2

Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

... (peptide backbone and side chains) exposed on denaturation. For various osmolytes, Bolen & Baskakov [3] have shown that: (a) the main driving force for the folding is the unfavourable interaction ... 1–12. 24 Singh LR, Dar TA, Haque I, Anjum F, Moosavi- Movahedi AA & Ahmad F (2007) Testing the paradigm that the denaturing effect of urea on protein stability is offset b...

Ngày tải lên : 07/03/2014, 00:20

9
547
0

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

... Italy Therapeutic strategies aimed at reducing brain damage after ischemic stroke have been a major focus of academic and industrial research for the past 30 years. Two primary therapeutic approaches ... pro -in ammatory mediators is probably a result of the fact that in ammatory transcription factors such as nuclear factor-kappaB, activator protein-1 and nuclear factor of ac...

Ngày tải lên : 07/03/2014, 03:20

10
417
0