Báo cáo khóa học: Localization, puriﬁcation and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot

... Localization, puriﬁcation and properties of a tetrathionate hydrolase from Acidithiobacillus caldus Zhanna Bugaytsova* and E. Bo¨ rje Lindstro¨mDepartment of Molecular Biology, Umea˚University, ... was satisfactory and that the tetrathionate hydrolase is a periplasmic enzyme. Puriﬁcation of the tetrathionate hydrolase from tetrathionate- grown A. caldus After cell lysis and dialysis, the crude ... positivecharges of tetrathionate hydrolase may result from theneutralization of the overall negative charge in the periplasm of the acidophilic A. caldus cells. As in A. caldus, tetra-thionate hydrolase...

Báo cáo khoa học: Coexpression, puriﬁcation and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

... GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA33 CCGGAATTCTTATTTCCCTTCTCTCATCTC40 GCGCGCCATGGAAAAAGATCTACAGTTAAGA41 GGGGGATCCCCATAATCCACTCCACCTGCTAAA44 GGGGGGGATCCT CATTATTTCCCTTCT66 AATACCGCCATGTATAATATCTATTACTTC67 ... AATACCGCCATGTATAATATCTATTACTTC67 GTAATAGATATTATACATGGCGGTATTGAA75 GGGGGGGCCATGGAAAGAGCAGACGATTT4294 H P. Chen et al.(Eur. J. Biochem. 271) Ó FEBS 2004assay k it was obtained f rom B io-Rad, H ercules, CA, USA. A ... Chemistry, Academia Sinica, Nankang, Taipei, TaiwanD-Ornithine aminomutase from Clostridium sticklandiicomprises two strongly associating subunits, OraS and OraE, with molecular masses of 12 800 and...

Báo cáo khoa học: Expression, puriﬁcation and characterization of the second Kunitz-type protease inhibitor domain of the human WFIKKN protein pot

... werepurchased from Sigma,D-Val-Leu-Lys-pNA and D-Pro-Phe-Arg-pNA were from Serva. Glu-Gly-Arg-pNA,D-Ile-Pro-Arg-pNA, Bz-Phe-Val-Arg-pNA,D-Val-Leu-Arg-pNA and succinyl-Ala-Ala-Ala-pNA were obtainedCorrespondence ... kallikrein (Calbiochem, Afﬁliate of Merck, Darmstadt) were commercial preparations.The synthetic substrates N-succinyl-Ala-Ala-Pro-Phe-pNA and N -a- benzoyl-L-Arg-pNA (L-BAPNA) werepurchased ... and 200 lMBz-Phe-Val-Arg-pNA substrate con-centration; human plasma kallikrein at 3 nMenzyme and 650 lMD-Pro-Phe-Arg-pNA substrate concentration, and the inhibition of human tissue plasminogen...

Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferﬁsh (Tetraodon ﬂuviatilis) ppt

... TGG AAC GAC GG gtaagggaac 172 ttttttttag A GCC ATA CTG Gly593 (2)15 143 AAC AAA GCA G gtatattcag 434 atgtttccag GT GAG AGA ATG Gly640 (1)16 156 CCG CCC CTT T gtaagcaacc 139 tcacctaaag CC AAA ... ttttctacag C ACC TTT ATT Ser331 (2)9 80 AAC ACA AGG AA gtaagttcaa 535 tctgccacag T GAA AGC AGT Ans391 (2)10 88 TTC AGG AAC ATG gtgagtgcct 306 atccttgtag TCC TTG AAG Met420 (3)11 123 TTT CAA GTG ... CTG TCC Ala184 (1)6 131 AAA TAC CGA CTG gtaaacccaa 79 atgataccag GAC CTG GCA Leu227 (3)7 152 CTG CAG TCA TG gtgagttgtc 231 tgcataacag G TGT GAG AAG Trp278 (2)8 156 CTG GTT ACC AG gtatctgcct...

Báo cáo khoa học: Expression, puriﬁcation and catalytic activity of Lupinus luteus asparagine b-amidohydrolase and its Escherichia coli homolog potx

... byglutamate-oxaloacetate t ransaminase (GOT) in the presence of a- ketoglutarate, and (c) formation of NAD+aftermalate dehydrogenase (MDH)-mediated reduction of oxaloacetate to m alate with NADH as cofactor. ... 3.5.1.1) are enzymes that catalyze thehydrolysis of L-asparagine toL-aspartate and a mmonia.Using amino acid sequences and biochemical properties ascriteria, e nzymes with asparaginase activit ... withliberation of an N-terminal t hreonine as a potential catalyticresidue.Keywords: asparaginase; isoaspartyl peptidase; aspartylglu-cosaminidase; Ntn -hydrolase; glutathione.L-Asparaginases...

Báo cáo khoa học: "Joint Identiﬁcation and Segmentation of Domain-Speciﬁc Dialogue Acts for Conversational Dialogue Systems" doc

... the average error and the standard deviation. The largest average er-ror happens with the data annotated with multipledialogue acts. In that case, the extracted segmentshave a starting and ... dialogue act labels in our dataset.The average number of words in utterances withonly a single dialogue act is 7.5 (with a maximum of 34, and minimum of 1), and the average length of utterances ... available combi-nations of dialogue acts per utterance result in sparsecoverage of the space of possibilities, unless a verylarge amount of data can be collected and anno-tated, which is often...

Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

... (5¢fi3¢)FLAG epitope GAC TAC AAG GAT GAC GAT GAT AAGDYKDDDDKLibrary template(FLAG-negative)TTG GGG CTG GAT GAC GCG GAT AAGL GLDDADKRandomization NNS NNS NNS GAT GAC NNS GAT AAGXXXDDXDKSelected ... proteins carrying a functionalFLAG epitope from an excess of FLAG-negative com-petitors and from a large library of random variantswas also undertaken by plasmid display, to confirmthe efficacy of ... underlying (ba)8-barrel. This was inves-tigated by comparing the far-UV and near-UV CDspectra of PRAI and FLAG-PRAI in a buffer inwhich PRAI retains catalytic activity (Fig. 3). Thespectra are effectively...

Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

... cerevisiaeMAP kinase cascades typically composed of three tiers of protein kinases, a MAP kinase (MAPK), a MAPK kinase(MAPKK) and a MAPKK kinase (MAPKKK), arecommon signalling modules in eukaryotic ... and Kholodenko et al. [19]. Among them, two recent remark-able developments are that of Kholodenko et al. [14]based on stationary experimental data, and that of Sontag et al. [15] based on time-series ... which can be useful when stationary data are notavailable and the strength of self-regulation at eachnode ⁄ module should be estimated as well. It is, however,only applicable to the case when...

Báo cáo khoa học: Puriﬁcation and properties of a new S-adenosyl-Lmethionine:ﬂavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... compo-nents of each reaction mixture, after their chromatographicseparation and puriﬁcation, were submitted to1HNMR(nuclear magnetic resonance) and FABMS (fast atombombardment mass spectrum) analyses ... Theconcentration of both the assayed compound and itsrespective transformation product was determined bycomparison of peak data with those obtained from authentic standards chromatographed at different ... S-Adenosyl-L-methionine:ﬂavonoid 4¢-O-methyltransferase crude activity in healthy and inoculated tissues of the carnation cultivar ¢Novada¢.In each row, values followed by a same number of * are not statistically...

Báo cáo khoa học: Molecular identiﬁcation and expression study of differentially regulated genes in the Paciﬁc oyster Crassostrea gigas in response to pesticide exposure doc

... 5¢-GCACAGTTCCCCTACAGTCCCGCTTTAG-3¢HSCR ADI and G (up) 5¢-CCTTTTTAGCAGTGACTTTCCGTTGCAA-3¢ 5¢-CACGTCTCAGCAGGGAGAATAATCCCGA-3¢Senescenteassociated protADI (up) 5¢-TTGCAACGACTGCAGTCATCAGTAGGGT-3¢ 5¢-GAGCTCAGCGAGGACGGAAACCTCGCGT-3¢LysosomalassociatedproteinADI ... 5¢-GAGCTCAGCGAGGACGGAAACCTCGCGT-3¢LysosomalassociatedproteinADI (up) 5¢-CCAATCAGGTAGGCCTTCATGGAGAGGA-3¢ 5¢-CCCAGAGATCCTCCAAGAGACAGCCAGT-3¢Elongation factor2 ADI (up) 5¢-ATCTGGAGAGCACATCATTGCTGGTGCA-3¢ 5¢-CTTTCTGGCCTCTCCAACATCCATGCCA-3¢Apolipophorin ... 5¢-TCTCCTACGATCATCTCACCGTCACCGA-3¢Guanyl cyclase ADI (down) 5¢-GGTTGTCAATTTATTGAATGATCTCTACA-3 5¢-CCTCGGATCTTGAGACCCTCGACTGGA-3¢ADP ribo G (down) 5¢-CATTTTGACTCGTCCCGATAAACAGGCA-3¢ 5¢-GTTTTACCGGCAGCATCCAACCCCACCA-3¢RiboL13...

Xem thêm