0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

... for polyunsaturated fatty acid (PUFA) biosynthesis. FAD, fatty acid desaturase; Elo, elongase; Elo5, D5 elongase; Elo6, D6elongase; AA, arachidonic acid; EPA, eicosapentaenoic acid; DHA,docosahexaenoic ... exhibits another variation in the first steps of the pathway. C18 FAs are elongated to C20, andthen a D8 desaturase produces the same kind of C20FAs that will be the substrate of D5 desaturase.Although ... containing vertebrate desaturases and the other formed by desaturases from higher plants and from the alga Thal. pseudonana.DiscussionWe have functionally characterized all front-end desaturases detected...
  • 10
  • 476
  • 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse oligonucleotide primers, respectively. The primers were designed ... coordi-nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or anaspartate. The apparent conflict of this finding with the absence of a coordinating carboxylate ... catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bondcleavage to yield methylglyoxal and acetate.Kinetic characterization of Fe2+Bxe _A2 876 The activity of Bxe _A2 876...
  • 15
  • 624
  • 0
Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

... Oncometopia nigri-cans, accession number AAU95196; HC, Homalodisca coagulata,AAT01076; AF, Artemia franciscana, AAL55398; ON2, Oncorhyn-chus nerka, AAK08117; SS, Salmo salar, AAB34575; TN, Tetraodonnigroviridis, ... work was supported by the Heart and StrokeFoundation of Nova Scotia, the Natural Sciences andEngineering Research Council of Canada, the NovaScotia Health Research Foundation, and the CanadianInstitutes ... ‘Guide to the Care and Use of Experimental Animals’ available from the Canadian Council on Animal Care. The identity of anti-body-reactive purified proteins as artemin was confirmed bymass spectometry...
  • 9
  • 434
  • 0
Báo cáo khoa học: Functional characterization of ecdysone receptor gene switches in mammalian cells docx

Báo cáo khoa học: Functional characterization of ecdysone receptor gene switches in mammalian cells docx

... were taken as refer-ence or blank. The counts of the radioactive ligand alonein the scintillation liquid cocktail were also measured andthese values were taken in the y-axis as total added. The reactions ... consists of the DEF domains of mutant CfEcR (EcRtvy andEcRtvay), GAL4 DNA binding domain and VP16activation domain. Various combinations of the EcRligand binding domain, VP16 activation domain andGAL4 ... switches. The main advantage of EcR geneswitches in mammalian system is that the ecdysteroids,which are used to induce the switch, are structurallydifferent from mammalian steroids, and they are...
  • 14
  • 323
  • 0
Báo cáo khóa học: Functional characterization of the evolutionarily divergent fern plastocyanin potx

Báo cáo khóa học: Functional characterization of the evolutionarily divergent fern plastocyanin potx

... Yoshizaki, F., Sasakawa, Y., Onodera,K., Nagatomo, S., Kitagawa, T., Uzawa, S., Isobe, Y., Sugimura,Y., Gotowda, M. & Kai, Y. (1999) The structure and unusual pHdependence of p lastocyanin from ... he amplitude of the fast phase of the l atter represen ted up to 40% of the totalamplitude, with a rate constant (kobs) independent of Pcconcentration (data not shown). From the kobsvalues ... with a 0–0.3MNaCl gradient and the protein was eluted directlywith the pH gradient in the chromatofocusing step, avo iding the l ast salt gradient. About 3 mg of pure Pc with anabsorba nce ratio...
  • 8
  • 373
  • 0
Báo cáo khoa học: Functional characterization of hepatocyte nuclear factor-4a dimerization interface mutants pot

Báo cáo khoa học: Functional characterization of hepatocyte nuclear factor-4a dimerization interface mutants pot

... 5¢-CAGGCTCACCAGCACCTGTGACC-3¢D312N for 5¢-AGCCTGGAGAATTACATCAACGAC-3¢D312N rev 5¢-GTCGTTGATGTAATTCTCCAGGCT-3¢R324L for 5¢-CTCTCGGGGTCTTTTTGGAGAGCT-3¢R324L rev 5¢-AGCTCTCCAAAAAGACCCCGAGAG-3¢Q336L ... 5¢-CCCACTCTGCTGAGCATTACCTG-3¢Q336L rev 5¢-CAGGTAATGCTCAGCAGAGTGGG-3¢HNF-N 5¢-GATATCAAGCTTGCCGCCGCCATGGACATGGCTGACTACAGTGCT-3¢HNF-C 5¢-TCTAGAGGATCCCTAGATGGCTTCCTGCTTGGTGAT-3¢E. Aggelidou ... 5¢-CGCATCCTCAATGAGCTGGTCTTG-3¢D261N rev 5¢-CAAGACCAGCTCATTGAGGATGCG-3¢E269Q for 5¢-TTGCCCTTCCAACAGCTGCAGATC-3¢E269Q rev 5¢-GATCTGCAGCTGTTGGAAGGGCAA-3¢Q307L for 5¢-GGTCACAGGTGCTGGTGAGCCTG-3¢Q307L...
  • 11
  • 400
  • 0
Báo cáo khoa học: Functional characterization of Drosophila melanogaster PERK eukaryotic initiation factor 2a (eIF2a) kinase pdf

Báo cáo khoa học: Functional characterization of Drosophila melanogaster PERK eukaryotic initiation factor 2a (eIF2a) kinase pdf

... preliminary work in the database search and thank Ignacio V. Sandoval and Vassiliki Laliotifor their assistance with subcellular fractionation analyses. We aregrateful to Encarnacio´nMartı´nez-Salas ... Wernli, B., Franklin, R.M. & Kappes, B.(1997) Molecular cloning, characterization and localization of PfPK4, an eIF 2a kinase-related enzyme from the malarial parasitePlasmodium falciparum. Biochem. ... in the ER [16].Localization and eIF 2a kinase activity of DPERK – the role of the N-terminal domainIt has been proposed that the N-terminal regulatory domain of mammalian PERK is located in the...
  • 14
  • 296
  • 0
Báo cáo khoa học: Functional characterization of the maltose ATP-binding-cassette transporter of Salmonella typhimurium by means of monoclonal antibodies directed against the MalK subunit pot

Báo cáo khoa học: Functional characterization of the maltose ATP-binding-cassette transporter of Salmonella typhimurium by means of monoclonal antibodies directed against the MalK subunit pot

... samesite but at the bottom part of the C-terminal domain. The only moderate effect of MalT on binding of 2F9 arguesagainst these residues being part of the MalT–MalKinteraction face. Rather, the epitope ... the a nity of the mAbs for soluble MalK, indicating a confor-mational change that renders the epitopes less accessible.4H12 and 5B5 inhibit the ATPase activity of MalK and the MalE/maltose-stimulated ... translocation pore, and two ATPasedomains (also referred to as ABC subunits/domains), thatprovide the energy for the transport process. The ABCdomains are characterized by a set of canonical Walker...
  • 12
  • 363
  • 0
Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

... withPhK5 and PhK13. In all runs the same concentration of Ca2+⁄ CaMwas used and a 1 : 1 molar ratio of peptide was added. The insetshows a Tris ⁄ tricine SDS ⁄ PAGE gel analysis of the peak fractions from ... to allow a better understanding of the hydrodynamic behaviour of Ca2+⁄ CaM andCa2+⁄ CaM ⁄ PhK5.HSQC spectra were taken after a series of increasingrelaxation delays to measure the T1 and ... in the bound form.Analysis of the R1 and R2 relaxation times foreach assigned peak in the Ca2+⁄ CaM and Ca2+⁄CaM ⁄ PhK5 samples supported the notion of a significant conformational change....
  • 12
  • 590
  • 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... bacterium make the under-standing of its pathogenic mechanisms an urgentchallenge [9,10]. S. aureus produces a variety of cellsurface-associated and extracellular factors that enablebacteria to ... FEBSMonoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB. Analysis of mAbs binding to the recombinant FnBR indicated the generation ... wereperformed at 25 °C. The sensorgrams (time course of the SPR signal in RU)were normalized to a baseline value of 0. All sensorgramdata presented were subtracted from the correspondingdata obtained from...
  • 16
  • 560
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP