Báo cáo khoa học: The CssRS two-component regulatory system controls a general secretion stress response in Bacillus subtilis pdf
Báo cáo khoa học: The CssRS two-component regulatory system controls a general secretion stress response in Bacillus subtilis pdf
... diluted in fresh medium and samples were takenat different intervals for absorbance readings at 600 nmand b-galactosidase activity determinations. To assayb-galactosidase activity, a semiautomated ... derivative containing the amyQ gene of B. amyloliquefaciens, encodingAmyQ with an artificial alanine-rich signal peptide; Kmr[26]pP43LatIL3 pMA5 derivative, containing the hIL-3 gene with the amyL ... high-levelproduction of the a- amylase AmyQ of Bacillus amyloliq-uefaciens in a prsA3–cssS double-mutant strain [3].High-level production of this a- amylase, or the related a- amylase AmyL from Bacillus licheniformis,...
- 12
- 428
- 0
Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt
... GCTTTGTTCGTGCAAATTTCC 55 35CTGCAAATATCTCTGGGAAGATRPC5 CAGCATTGCGTTCTGTGAAAC 55 35CAGAGCTATCGATGAGCCTAACTRPC6 GACATCTTCAAGTTCATGGTCATA 55 35ATCAGCGTCATCCTCAATTTCTRPC7 CAGAAGATCGAGGACATCAGC 55 ... 25TGCACTTGGCGTTCTTGTTRPC1 GATTTTGGAAAATTTCTTGGGATGT 55 35TTTGTCTTCATGATTTGCTATCATRPC2 CATCATCAT-GGTCATTGTGCTGC 55 35GGTCTTGGTCAGCTCTGTGAGTCTRPC3 GACATATTCAAGTTCATGGTCCTC 55 35ACATCACTGTCATCCTCAATTTCTRPC4 ... (5¢-to3¢)AnnealingT (°C)CyclenumberActin TGTTGGCGTACAGGTCTTTGC 60 23GCTACGAGCTGCCTGACGGGAPDH TATCGTGGAAGGACTCATGACC 55 20TACATGGCAACTGTGAGGGGTSP1 CCGGCGTGAAGTGTACTAGCTA 65 25TGCACTTGGCGTTCTTGTTRPC1...
- 13
- 609
- 0
Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf
... chaperones that facilitate protein fold-ing and suppress protein aggregation, this response plays a major role in maintaining protein homeostasis. The heat shock response is regulatedmainly at the level ... HSF-mediatedmechanisms of cellular adaptation to stress in verte-brates by comparing mammalian and avian cells, andalso review HSF-mediated mechanisms of adaptationto pathological states related ... polyglutamine diseases. These diseasesare characterized by conformational changes in disease-causing proteins that results in misfolding and aggrega-tion, and are therefore termed protein-misfoldingdisorders...
- 14
- 687
- 0
Tài liệu Báo cáo khoa học: The cartilage-specific transcription factor Sox9 regulates AP-2e expression in chondrocytes pptx
... integrin alpha10-for, 5¢-CATGAGGTTCACCGCATCACT-3¢, and integrin alpha10-rev, 5¢-AAGGCAAAGGTCACAGTCAAGG-3¢ (annealing temperature64 °C). The expression ratios of the analyzed geneswere calculated ... 5¢-GATCCTCGCAGGGACTACA-3¢, and AP- 2a- rev, 5¢-GTTGGACTTGGACAGGGAC-3¢ (annealing temperature 60 °C);Sox9-for, 5¢-CGAACGCACATCAAGACGA-3¢, and Sox9-rev, 5 ¢-AGGTGAAGGTGGAGTAGAGGC-3¢ (annealingtemperature 58 °C); integrin ... was performed using specificprimers: AP-2e-for, 5¢-GAAATAGGGACTTAGCTCTTGG-3¢, and AP-2e-rev, 5¢-CCAAGCCAGATCCCCAACTCTG-3¢ (annealing temperature 59 ° C); AP- 2a- for, 5¢-GATCCTCGCAGGGACTACA-3¢,...
- 11
- 605
- 0
Tài liệu Báo cáo khoa học: The double-stranded RNA-binding motif, a versatile macromolecular docking platform doc
... A part-nership with a catalytic domain is observed in the RNA-dependent protein kinase (PKR) that contains a serine ⁄ threonine kinase domain [7–9] and in the dsRNA-specific adenosine deaminases ... ⁄ Drosha [12–14] RNase III domain a dsRNA processing in RNAi ⁄ miRNA pathwayADAR1 & 2 [10] A fi I deaminase domain RNA editingRHA [11] DEXH helicase domain Transcriptional coactivatorPKR ... double-stranded RNA-specific adenosine deaminase ADAR1proteins reveal functional selectivity of double-strandedRNA-binding domains from ADAR1 and proteinkinase PKR. Proc Natl Acad Sci USA 97, 12541–12546.44...
- 9
- 542
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCAVps4–TRP F TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGAVps4–TRP R TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAAVps4–RDF F GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTGVps4–RDF R CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTCTable ... interacting and traffickingdomain required for endosome recruitment, an AAA domain containing the ATPase catalytic site and a b domain, and a C-terminal a helix posi-tioned close to the catalytic ... Structural analysis of Vps4revealed that it contains a single ATPase domainincorporating a structure rich in b strands (b do-main), an N-terminal microtubule interacting andtrafficking (MIT) domain...
- 23
- 490
- 0
Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf
... h, and D595readings takenevery 30 min to assess the rate of bacterial growth. The D valueswere calculated relative to the initial readings in the same samples.An asterisk denotes mean values ... ofAchatinin, a 9-O-acetyl sialic acid-binding lectin, withlipopolysaccharide in the innate immunity of Achatinafulica snails. Mol Immunol 37, 745–754.P. Melamed et al. C-type lectins in the male ... pregnancy. After removal of all embryos, the inner tissuelining the pouch was pulled away from the muscle wall, andRNA was extracted using TRIzol (Invitrogen, Carlsbad,CA). The cDNA library was...
- 15
- 379
- 0
Báo cáo khoa học: The binding of IMP to Ribonuclease A pptx
... Stereodiagrams of the interactions ofAMP in the RNase A active site. The sidechains of protein residues involved in ligandbinding are shown as ball-and-stick models.Bound waters are shown as black ... Thus, although the Table 4. Van der Waals interactions of IMP and AMP in the active site of RNase A. IMP ⁄ AMPatomRNase A IMP RNase A AMPIMP Mol I IMP Mol II IMP Mol III RNase A Mol A RNase A ... with RNase A in the crystal. Hydrogen bond interactions were calculated with the pro-gramHBPLUS [65].Values in parentheses are distances in A ˚.IMP ⁄ AMP atomRNase A IMP RNase A AMPIMP...
- 14
- 360
- 0
Báo cáo khoa học: The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids doc
... mLÆmin)1with a lineargradient from 100% B to 43% B within 45 min, to 0% Bwithin 1 min, then increasing the flow rate to 2 mLÆmin)1within 1 min and maintaining these final conditions foranother ... source of apocarotenoids. In mam-mals, the synthesis of apocarotenoids, including retinoic acid, is initiatedby the b-carotene cleavage oxygenases I and II catalyzing either a centralor an excentric ... developed at a flow rate of 450 lLÆmin)1with90% A and 10% B for 5 min, to 5% A and 95% B within10 min, then increasing the flow rate to 900 lL within 2 minand maintaining these final conditions...
- 12
- 377
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP