0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

... Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G- protein- coupled receptor and G protein originated from evolutionarily ... 5¢-CAGAATTCatggagcagaagctgatctccgagga ggacctg ctg GTGAACAACTCCACCAACTCCTCCAACAACTCCCTGGCTCTTACAAGTCCTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCGCCTATGTTCTTATAATG-3¢. (An engineered EcoRIrecognition ... M2in the GOA-1 fusion protein is functional, and the ligand-binding properties agree with that of the Gai1fusion protein. Activation of GOA-1 by muscarinic agonistsAgonist-bound GPCRs are...
  • 9
  • 400
  • 0
Báo cáo khoa học: Cysteine residues exposed on protein surfaces are the dominant intramitochondrial thiol and may protect against oxidative damage docx

Báo cáo khoa học: Cysteine residues exposed on protein surfaces are the dominant intramitochondrial thiol and may protect against oxidative damage docx

... mea-surement of GSH and GSSG using the recycling assay [11].Glutathione protein mixed disulfides were determined by reducing the protein pellet with sodium borohydride and mea-suring the released GSH ... by 1–1.5 nmolÆmg protein )1 and ledto the formation of GSSG and up to 0.4 nmolÆmg protein )1 of protein mixed disulfides (Fig. 2A, B).Under these conditions, there was a loss of 9–19nmolÆmg ... ( 150 lg of protein per lane) wereseparated by BN-PAGE, the complex I band excised and further separated by SDS-PAGE and then immunoblotted using an antibody against 3-nitrotyrosine. The blot...
  • 16
  • 379
  • 0
Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

... 5¢-TGCAGATTCCGCAATCTGCA-3¢ [34]; 3A1–300, 5¢-AGTCCTTCTGTAATGGTGTG-3¢; 3A1–600, 5¢-TGCAGGATTGCAGAAGTCTATT-3¢; 3A1-700, 5¢-AATTTTGGTGGATAGATATAG-3¢; m3A1-300, 5¢-AGTCCGTCTATGGTGGTGTG-3¢;m3 A1-600, 5¢-TGCAGGACCGTAGAGGTCTATT-3¢(mutated ... binding sites were as follows(mutated bases underlined): site 3A1-300: 5¢-GGAGAAAGTCCGTCTATGGTGGTGTGCAGATGACACAGTTTTGGC-3¢; site 3A1-600: 5¢-GCCTCTGCTCTGTAAGTGCAGGACCGTAGAGGTCTATTACTTATG-3¢.mRNA ... oligonucleotides encompassing the twodistinct CYP3A1 5¢ sites 3A1-300 ()350/)331, 5¢-GTCCTTCTGTAATGGTGTG-3¢), or 3A1-600 ()629/)608, 5¢-TGCAGGATTGCAGAAGTCTATT-3¢).Thesewere ligated with the...
  • 9
  • 425
  • 0
Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

... isolated from the whole fruit body. The primer combinations TTC CCA GAG ATC GAGTCA ATG CGT (3¢-to5¢) and TCT GTC GTA CCAACC AGT TGA (5¢-to3¢), designed on the basis of peptides 15 (FPEIESMR) and ... SDS-PAGE, and protein bands were visualized by Coomassie BrilliantBlue R-250 staining. The 55 kDa protein band was excised from the gel and in-gel digested with modified trypsin of sequence grade ... align the remaining six sequenced peptidesto the C-terminal part of the L. bicolor protein EDR12198.1 (Fig. S2). A high degree of similaritybetween the partial sequence of toxophallin and the amine...
  • 10
  • 473
  • 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... was introduced using a QuikChange kit (Stratagene,La Jolla, CA, USA) and the human FVII expression plas-mid pLN174 [38]. The sense primer 5¢-GGCTGCGCAACCGTGGCCCACTTTGGGG-3¢ and a complementaryreverse ... catalyticefficiency, the overall functional defect of G3 72A-FVIIa was, if anything, smaller in the presence of TF,which suggests that the allosteric effect of TF, influenc-ing burial of the N-terminus, and the ... residue. The magnitude of the effects of the G3 72(223)A mutation is slightlysubstrate-dependent. The fact that the relative reduc-tion in activity was not greater in the presence of cofactor strongly...
  • 11
  • 619
  • 0
Tài liệu Báo cáo khoa học: Activation of the Torpedo nicotinic acetylcholine receptor The contribution of residues aArg55 and cGlu93 ppt

Tài liệu Báo cáo khoa học: Activation of the Torpedo nicotinic acetylcholine receptor The contribution of residues aArg55 and cGlu93 ppt

... within the cholinergic ligands-bindingsites of the acetylcholine receptor by photoaffinity label-ling: additional evidence for a three-loop model of the cholinergic ligands-binding sites. J Biol ... binding of agonists [23]. In the GABAA receptor, the F64L mutation of the a1subunit had a dramatic effect on GABA sensitivity[24] and mutations of the F77 residue of the c2 subunitsignificantly ... Schematic representation of the subunitarrangement of the Torpedo nAChR showing the ‘six binding loop’model of high affinity ligand binding sites. Also represented is loopD of the a-subunit (not...
  • 11
  • 517
  • 0
Báo cáo khoa học: Activation of activating transcription factor 2 by p38 MAP kinase during apoptosis induced by human amylin in cultured pancreatic b-cells ppt

Báo cáo khoa học: Activation of activating transcription factor 2 by p38 MAP kinase during apoptosis induced by human amylin in cultured pancreatic b-cells ppt

... unlabelled oligo-nucleotides, either specific (containing the CRE sequence),or nonspecific [containing the SP1 binding site (5¢-ATTCGATCGGGGCGGGGCGAGC-3¢) in 200-fold excess],were added to the reaction ... isolatedusing DNAzol reagent (Invitrogen) as previously described[16]. A 636 nt DNA fragment for the c-jun promoter wasgenerated by PCR using primers: 5¢-CCCAAAACCACTGGCCTGGTTC-3¢ and 5¢-CACAGGCGCTAGATCTGGGCAG-3¢. ... Trust, and the New Zealand Lot-tery Grants Board, and by Programme Grants from the New Zealand Health Research Council to GC and MD, and from the Foundation for Research, Science and Technology (NZ)...
  • 13
  • 400
  • 0
Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx

Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx

... ⁄ n-3 ratio 1 and ratio 2 in the pregnant glandcompared with the virgin gland, respectively, suggest-ing a preferential accumulation of n-3 over n-6 PUFAin the gland during pregnancy.Preferential ... asmolecular changes observed in the gland from the transgenic mice resemble the differentiated phenotypein the gland from the early pregnant mice. The transcriptional activation of b-casein geneexpression ... 60%in the MRG gland. The relative concentration of EPAwas slightly increased, but not statistically significant,in the MRG gland versus the control gland. Our datanot only confirm the role of MRG...
  • 12
  • 421
  • 0
Báo cáo khoa học: Activation, regulation, and inhibition of DYRK1A Walter Becker1 and Wolfgang Sippl2 pptx

Báo cáo khoa học: Activation, regulation, and inhibition of DYRK1A Walter Becker1 and Wolfgang Sippl2 pptx

... to the hinge region (backboneNH of M24 0) and one to the conserved K188. Basedon the model of the DYRK1A ⁄ harmine complex, it issuggested that the accessible volume of the ATP bind-ing pocket ... nega-tively regulated by DYRK1A [34]. The presence of potentially destabilizing AUUUA elements in the 3¢-UTR of the DYRK1A mRNA and the PEST regionin the DYRK1A protein [1] supports the hypothesisthat ... phosphorylation-regulated kinase 1A; EGCG, epigallocatechin-gallate; GSK, glycogen synthase kinase; MAPK, mitogen-activated protein kinase; MNB, protein kinase encoded by the minibrain gene from Drosophila;...
  • 11
  • 408
  • 0
Báo cáo khoa học: Activation of hepatocyte growth factor activator zymogen (pro-HGFA) by human kallikrein 1-related peptidases docx

Báo cáo khoa học: Activation of hepatocyte growth factor activator zymogen (pro-HGFA) by human kallikrein 1-related peptidases docx

... 5¢-GGGAAATGAGAAATGCAGCCA-3¢; HGF ⁄ SF reverse, 5¢-AGTTGTATTGGTGGGTGC-3¢;GAPDH forward, 5¢-GTGAAGGTCGGAGTCAACG-3¢;GAPDH reverse, 5¢-GGTGAAGACGCCAGTGGACTC-3¢. The PCR products were analyzed by ... [13]: HGFA forward,5¢-CCACTTGGATGAGAACGTGA-3¢; HGFA reverse,5¢-ATGATGCCGTAGAGGTAAGC-3¢; MET forward,5¢-TTGCCAGAGACATGTATGATAAAGAATACT-3¢;MET reverse, 5¢-TTGTCACTGGGGAAATGGAT-5¢;HGF ⁄ SF ... 5¢-GATCCACTTCCGGTAATGCACCACC-3¢; KLK4 forward, 5¢-AATCATAAACGGCGAGGACTGCAG-3¢; KLK4 reverse, 5¢-TTAGCGAGCAAGGGTCTGTTGTAC-3¢; KLK5 forward, 5¢-TGTGCTCTGATCACAGCCTTGCTT-3¢; KLK5 reverse,5¢-CCAGCATTTTAGCATTACTT-3¢;...
  • 15
  • 348
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ