0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

... c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis Dan Sato1,*, Wataru Yamagata2, ... catalyzes the a, c-elimination and c-replacement of l-Met and homocysteine (Hcy), and a, b-elimination and b-replacement of l-Cys and S-substituted analogs, and produces ammonia, a- ketoacids, and ... certain lin-eages of bacteria, plants, and protozoa but missing in mammals, catalyzes the single-step degradation of sulfur-containing amino acids (SAAs) to a- keto acids, ammonia, and thiol compounds....
  • 13
  • 406
  • 0
Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

... mM Mes (pH 7) and substrate (5¢-G2CCCUCUAAAAA-3¢)at50°C[6].cSubstrate-cleavage reaction (exogenous guanosine-mediated) of the substrate (5¢-CUUAAAAA-3¢) using the Anabaena ribozyme(L-8 ... 1)[14,17,21].Dependence of substrate cleavage on pHIt has been reported that the rate of the substrate-cleavage step in Tetrahymena [22–25], Anabaena [14] and Azoarcus [17] group I introns, as well as reactionsteps ... USA). Data were fit using the kaleidagraph curve-fittingprogram (Synergy Software, Reading, PA, USA). The finalconcentration of the radiolabeled substrate in all reactionsis 1.3 nm. A typical...
  • 13
  • 761
  • 0
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

... properties and subcellular localization patterns of the enzyme.USP7 is phosphorylated at S18 and S963, and ubiquitinated at K869 inmammalian cells. In in vitro activity assays, N- and C-terminal truncationsaffected ... M1 and E20, an alpha helix from there and up to amino acidG28, followed by a b-sheet starting at T36 and extend-ing to residue L49, and a larger helix including aminoacids A5 5 to R66. Based ... require the interactionwith a rapidly titrated endogenous factor, rather than a NLS [46]. Remarkably, the TRAF domain of USP7also interacts with several nuclear proteins such as p53,mdm2 and the...
  • 15
  • 592
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Automatic Collection of Related Terms from the Web" pptx

... transla-tion. The target application of the method is auto-matic or semi-automatic compilation of a glossary ortechnical-term dictionary for a certain domain. Re-cursive application of the ... Automatic Collection of Related Terms from the WebSatoshi Sato and Yasuhiro SasakiGraduate School of InformaticsKyoto UniversitySakyo, Kyoto, 606-8501Japansato@i.kyoto-u.ac.jp, sasaki@pine.kuee.kyoto-u.ac.jpAbstractThis ... termsT✛Filtering✛✓✒✏✑candidatesXFigure 1: System configurationAutomatic acquisition of technical terms in a cer-tain domain has been studied as automatic termrecognition (Kageura and Umino, 1996; Kageuraand...
  • 4
  • 437
  • 0
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

... observe the appearance of twopeaks at 1618 and 1683 cm)1, which are typical of the formation of an intermolecular antiparallel b-sheetaggregate [21]. The thermal stability of b-glucosidase was assessedby ... acid and the DNA level, respec-tively; they also have a similar catalytic mechanism and substrate specificity. However, the molecular basis of the high thermostability appears to be different. A biochemical ... inactivation was measured within a few hours. The measured activities were that of the untreated blank sample (A 0), the pressurized blank sample (A 10) and the sample thatwas kept at a predefined...
  • 9
  • 340
  • 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... 5¢-GAGCCAACAGAAGTTTGCTTCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 (1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 ... containing PHD domain;unknown functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040...
  • 15
  • 586
  • 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed ... Wellenreuther and W. Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data ... catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bondcleavage to yield methylglyoxal and acetate. Kinetic characterization of Fe2+Bxe _A2 876 The activity of Bxe _A2 876...
  • 15
  • 624
  • 0
Tài liệu Báo cáo khoa học: Kinetic analysis of effector modulation of butyrylcholinesterase-catalysed hydrolysis of acetanilides and homologous esters pdf

Tài liệu Báo cáo khoa học: Kinetic analysis of effector modulation of butyrylcholinesterase-catalysed hydrolysis of acetanilides and homologous esters pdf

... 7.0 at 25 °C. The effect of each ligand on related pairs of substrates (neutral substrates o-NAC and o-NPA, and positivelycharged substrates ATMA and ASCh) was compared. Toavoid complications ... analysis of BuChE AAA activity was carried out with a positively charged acetanilide (ATMA), a negativelycharged acetanilide (NATAc) and neutral acetanilides(o-NAC and o-NTFNAC). The stock ... 41141–41147.30 Majundar R & Balasubramanian AS (1984) Chemicalmodification of acetylcholinesterase from eel and basalganglia: effect on the acetylcholinesterase and arylacylamidase activities. Biochemistry...
  • 15
  • 544
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... at the same time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The ... estimated directly from the values of absorbance at these maxima (data notshown). The estimated association constants for imi-dazole and azide binding to heme–GmHO-1 are sum-marized and compared ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu O from Corynebacterium...
  • 16
  • 617
  • 0
Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

... DASApolarare the changes inASA of the apolar and polar residues, respectively[39]. The structure-based calculations provide a DCp of )407 calÆmol)1ÆK)1 and DASAapolar and DASApolar of )1354 and ... and without the receptor N-domain using the vadar program[41]. The DCpwas calculated using the following equa-tion:DCp¼ 0:45DASAapolarÀ 0:26 ASApolarwhere DASAapolar and DASApolarare ... Empiricalequations have been derived that allow comparison of the experimental thermodynamic parameters and structure-based calculated parameters based on sur-face area parameterization. This approach...
  • 11
  • 549
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)