Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... the peroxisomal aspartate aminotransfer-ase Aat2p in HPLC fraction 7 at a molecular mass ofapproximately 45 kDa (Fig. 1A) [15].The predicted molecular mass of Lpx1p is 44 kDa.It carries a peroxisomal ... preparations in triplicate. Candida rugosa lipase (CRL) was usedas a positive control for lipase measurement. (Pancreas) lipase activity assays used DGR in a coupled enzyme assay as a sub-strate. ... Woolford CA, Noble JA, Garman JD, Tam MF, InnisMA & Jones EW (1993) Phenotypic analysis of protein-ase A mutants. Implications for autoactivation and thematuration pathway of the vacuolar...
- 11
- 568
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... 252.221.81.41.21.610.80.60.40.20 A 600 A 600 A 600Time (h)Fig. 5. His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable. Growth plots and time courses ofnitrite appearance and disappearance for P. ... 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene cluster for dissimilatory nitrite reductase (nir)from Pseudomonas aeruginosa: sequencing and identifi-cation of a locus for heme ... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA...
- 12
- 613
- 0
Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf
... sulfoxide were added to each well and gently shaken for 10 min. The absorbance was determined at 492 nm withplate reader (Sunrise, Tecan, Gr¨odig, Austria).Data analysisData were analyzed by ... reactionvolume with rTaq DNA polymerase or LA TaqTMDNApolymerase with GC buffer (TaKaRa). Human NANOGP8mRNA was amplified by RT-PCR using total RNAsextracted from urinary bladder cancer tissue. ... and tissues usingTrizol (Invitrogen, Carlsbad, CA, USA) reagent followingthe manufacturer’s instuctions. Total RNA was digestedwith RNAase-free DNase I (TaKaRa Carlsbad, CA, USA)at 37°C for...
- 8
- 495
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢, ... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as the only open readingframe present ... Flo11_lacZ_fwd 5¢-GTTTAGAATTCGATTGTAGGCAGAA-3¢ and Flo11_lacZ_rev5¢-AGGATCCAAATAAGCGAGTAGAAAT-3¢,respec-tively. Plasmid pYLZ-6 was converted to an integrationplasmid, as suggested [15], and...
- 8
- 485
- 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... probe and a sense cDNA probe (complementary tothe antisense) for mouse Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All ... genes and connective tissue pattern-ing. Development 121, 693–705.16 Ozaki H, Watanabe Y, Takahashi K, Kitamura K,Tanaka A, Urase K, Momoi T, Sudo K, Sakagami J,Asano M et al. (2001) Six4, a ... Promotion andMutual Aid Corporation for Private Schools of Japan(KK) and The Research Award to JMS GraduateStudent (ZA).References1 Kawakami K, Sato S, Ozaki H & Ikeda K (2000) Sixfamily...
- 16
- 476
- 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx
... used for generating the five mutants were:C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGTGAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGTAGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAAGCCGTTGTAGTTTTTGGTGAATCTT-3¢; ... site-specificmutagenesis – distal effects on dimer stabilityMoumita Samanta1, Mousumi Banerjee1, Mathur R. N. Murthy1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian ... 5¢-TAATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢;and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTTGG TGAATCTT-3¢.Protein expression and purificationThe TIM gene carrying the mutation was expressed inE. coli AA200...
- 12
- 393
- 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... transvacuolar strands and maintain overallcellular architecture. As mentioned above, CRP1 mayparticipate in the formation and ⁄ or maintenance oflong actin cables [12]. Consistent with this ... proteins and interacts withskeletal a- actin in the cytoplasm. However, little is known about the mechanism whereby hhLIM interactswith skeletal a- actin and regulates the organizationand rearrangement ... centrifuged at 10 000 g for 30 min,and the supernatant was used for the assay (F-actin). Thesupernatant of the lysates was incubated at room tempera-ture for 30 min with 0.3 mgÆmL)1F-actin in a solution...
- 11
- 347
- 0
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
... amylin to evaluate its effect onamylin aggregation. Samples were incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scat-tering assays and HPLC analysis at selected ... aggregation may begin to appear.This promotional effect will then lead to enhancedamyloid formation and make amyloid degradationmore difficult. We showed that this promotional effectwas significantly ... (Figs 1 and 3B).Taking amylin alone as a reference, after incubation for 72 h (Fig. 3B), there was approximately twice asmuch fibril formation when amylin was incubated with a low molar ratio of...
- 7
- 388
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... Seligman PA & Allen RH (1978) Characterization ofthe receptor for transcobalamin II isolated from humanplacenta. J Biol Chem 253, 1766–1772.22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... Aarhus, Denmark5 Department of Clinical Biochemistry, AS Aarhus University Hospital, DenmarkCobalamin (Cbl, vitamin B12) is a cofactor for twocrucial enzymes in mammals [1]. Therefore, anenhanced ... plasmon resonance.Anal Biochem 305, 1–9.16 Wuerges J, Garau G, Geremia S, Fedosov SN, PetersenTE & Randaccio L (2006) Structural basis for mamma-lian vitamin B12transport by transcobalamin....
- 12
- 603
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... TCATCTTTTAAACTTTGGGCGAAGGCGTTT23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT9 ... TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23...
- 9
- 444
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ