Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt
... -ATC ATC TCCATC GAC TAC TCC CTG-3¢, the antisense primer5¢-AAG AATTCT AGA TTA ATG GTG ATG ATG GTGATG ATG GTG TGG GGT CAG CGG TGC AGC AGGGGG GGT-3¢ (XbaI sites underlined; His-tag in italic) ... activity by bis-ANS wasdecreased upon phosphorylation. A possible explana-tion for this apparent discrepancy could be that PKA phosphorylation induces a conformational change thatincreases the accessible ... phosphorylated HSL binds more avidly to the polar head of the phospholipids and that this is fol-lowed by an interaction between the apolar acyl chains of the phospholipids and side chains of particularamino...
- 11
- 562
- 0
Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt
... McIntosh EM & Haynes RH (1984) Isolation of a Saccharomyces cerevisiae mutant strain deficient indeoxycytidylate deaminase activity and partial charac-terization of the enzyme. J Bacteriol 158, ... Coordinatedclosure of the active site and rearrangement of the main chain and side chains in the active site appearas key players in a slow transformation from aninactive to an active enzyme. dTTP ... of dCTPdeaminase.Mutational analysis of amino acid residuesinvolved in dTTP regulation of dCTP deaminase The design of the mutant enzymes H12 1A and V122Gwas inspired by the results from analysis...
- 11
- 577
- 0
Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx
... 3¢-GGAACCACGAAAGTAG CAATC AGA ACACTA AAACC A GGTACAATGATGC-5 ¢ . All vector inserts weresequenced prior to use.CDK4 pY17 antibody generationMurex lop-eared rabbits were injected with a phosphopep-tide ... C-YES and C-SRC were assayed for Y17 kinase activityusing the plate format assay at various concentrations of the Srcfamily kinase inhibitor PP2. Values are the average of four samplesnormalized ... kinase. (A) The ammo-nium sulfate precipitated HeLa nuclear lysate was fractionated by butyl-sepharose chromatography and the even numbered frac-tions were assayed for Y17 kinase activity and...
- 11
- 456
- 0
Tài liệu Báo cáo khoa học: Reconstitution of coupled fumarate respiration in liposomes by incorporating the electron transport enzymes isolated from Wolinella succinogenes docx
... treated in the same way as describedabove. The reaction was started by the addition of fumarateinstead of DMN, and the consumption of fumarate wasrecorded in a se parate experiment in the absenc ... technical reasons, the H+/e ratio of apparent protontranslocation can only be measured at vanishing Dp.Itisgenerally thought that the same ratio is valid in the presenceand a bsence of Dp. As the ... catalyze DMNH2oxidation by fumarate. In contrast, the activity of fumarate reduction by benzyl viologen radicalas well as the crystal structure of the enzyme and the midpoint potentials of...
- 10
- 569
- 0
Báo cáo khoa học: Complementation of coenzyme Q-deficient yeast by coenzyme Q analogues requires the isoprenoid side chain ppt
... this was a valid assumption as loss of area from the CoQ2H2and decylQH2peaks was compara-ble with the gain in size of the CoQ2and decylQ peaks.Determination of the fraction of CoQ2and ... library A genetically stable double-knockout Dcoq2DORF MATalibrary was created using the approach of Tong andcoworkers [14]. We utilized the commercially available dip-loid yeast strain MATa ... an A 600 of 0.8 (data not shown). Therefore, theirutilization of glucose for growth was grossly normaland they were unable to make the transition to the uti-lization of glycerol as a carbon...
- 16
- 499
- 0
Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx
... upregulation of both RGSmRNA was found only after activation of the TLR3signalling pathway. This upregulation of RGS1 andRGS2 mRNA is due to the TRIF pathway. We veri-fied the data by stimulation ... stimu-lates the GTPase activity of several members of the Gai subfamily but is ineffective against Gas[21],whereas RGS2 does not interact with Gai,Gao,Gasand Ga12 ⁄ 13at all; RGS2 acts ... TRIF-depen-dent pathway. Poly(I:C) induced upregulation of RGS1 and RGS2mRNA expression via a TRIF-dependent pathway To further analyse the regulation of RGS1 and RGS2mRNA after activation of TLR3 signalling...
- 11
- 569
- 0
Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf
... counteracting the glycosylation pattern associated to malignancy.We found in fact that NeuAca2-3Galb1-3[Fuca1-4]Glc-NAcb1-3Gal and NeuAca2-3Galb1-3GlcNAcb1-3Gal are the main oligosaccharides released by ... b1,4- and b1,3galactosidases,giving rise to a disaccharide and a monosaccharide, andwas thus identified as a mixture of Galb1-4[Fuca1-3]Glc-NAcb1-3Gal and Galb1-3[Fuca1-4]GlcNAcb1-3Gal. The calculated ... b1,3- and b1,4galactosidases, giving rise to a disac-charide and a monosaccharide, and is thus identified as a mixture of Galb1-3GlcNAcb1-3Gal and Galb1-4Glc-NAcb1-3Gal. The tetrasaccharide...
- 9
- 460
- 0
Tài liệu Báo cáo khoa học: Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide docx
... 5 ¢-GCAACACCATGGCTTCTTACAAAGTGAAA-3¢ and Fdlw 5¢-CCACAAGCTTGATATCATATCATAGCATAGCAGT-3¢ and the full length p ea Fdprecursor cDNA as template. To facilitate the cloningprocess, NcoIandHindIII ... Fd-NADP+reductase was purified accordingto published procedures [32].Fld from Anabaena was k indly provided by M. Medina(University of Zaragoza, Zaragoza, Spain). ApoFld fromAnabaena Fld was ... [29] was obtained by inserting an adapter formed from oligonucleotides 1(TTGGTTCCGCGTGGATCCCGAGCT) and 2 (AGTTCCAGTTCCCAACATGATGATGACAGTAGC) at the SacI s ite of plasmid pGF105 [30]. The insertion...
- 12
- 585
- 0
Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc
... [40].Two major pathways for caspase activation havebeen identified: the receptor pathway and the mito-chondrial pathway; both pathways trigger a cascade of downstream caspases that induces DNA fragmentation[2]. ... mitochondrial pathway [47]. Caspase-9 is alsocleaved by caspase-3 at another cleavage site. How-ever, this fragmentation does not have caspase activity.It enhances the activation of other caspases by alleviat-ing ... mitochon-drial proteins, caspases, transcriptional factors andnuclear proteins. Phosphorylation of MAPK signaling pathwaysMany protein kinases are associated with cell survivaland death; a key pathway...
- 15
- 784
- 0
Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx
... indicated strainswere grown to stationary phase and then lipids were extracted andseparated by TLC. The amount of SE of the wildtype strain was setat 100%. Data are mean values of three independent ... substratum [10].Among the Cdc42p effectors that regulate cell polari-zation are Ste20p and Cla4p, both members of the p21-activated kinase (PAK) family [4,11]. Cla4p promotes the assembly of the ... E, Krappmann S, Fink GR &Braus GH (1999) Crosstalk between the Ras2p-con-trolled mitogen-activated protein kinase and cAMPpathways during invasive growth of Saccharomyces cerevisiae. Mol...
- 12
- 699
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP