Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
... Journal compilation ª 2009 FEBS Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold Yasuyuki Kawashima1,*, Taku Ohki1,*, Naoki Shibata2,3,*, ... mutagenesis.Roles of Asn266Superimposition of Hyb-24DNY with the class A b-lactamase revealed that Asn266 of Hyb-24DNY has a similar spatial position to that of Glu166 in theclass A b-lactamase ... Higuchi2,3, Yoshiaki Wakitani1,Yusuke Matsuura1, Yusuke Nakata1, Masahiro Takeo1, Dai-ichiro Kato1and Seiji Negoro11 Department of Materials Science and Chemistry, Graduate School of Engineering,...
- 10
- 625
- 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... Bxe _A2 876 (accession numbergi:91782944) was amplified from genomic DNA of B. xenovo-rans LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in theacquisition of CD and DLS data is gratefully acknowl-edged. ... coordi-nated by an oxygen donor group derived from thecarboxylate side chain of either a glutamate or anaspartate. The apparent conflict of this finding with the absence of a coordinating carboxylate...
- 15
- 624
- 0
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx
... hypophos-phatasia, (c) childhood hypophosphatasia, (d) adulthypophosphatasia and (e) odonto hypophosphatasia[1–4]. Perinatal and infantile forms of hypophosphata-sia are severe and are usually transmitted ... alkalinephosphatase with missense mutations causinghypophosphatasia. Eur J Med Genet 50, 367–378.28 Cai G, Michigami T, Yamamoto T, Yasui N, StomuraK, Yamagata M, Shima M, Nakajima S, Mushiake S,Okada ... M, Amizuka N, Hoshi K, Ozawa H, KumagaiH, Omura S, Misumi Y, Ikehara Y & Oda K (1998)Intracellular retention and degradation of tissue-nonspe-cific alkaline phosphatase with a Gly317fi Asp...
- 11
- 500
- 0
Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc
... lyase pathway). Bottom: cleavage toyield AMPA and glyoxylate (the AMPApathway), referred to as the GOX pathway.(B) Reaction catalyzed by GO on glyphosate,an alternative to the AMPA pathway ... meth-ods of computational enzyme design are advancing tothe point that de novo design of an enzyme with a par-ticular and novel catalytic function is a reasonableL. Pollegioni et al. Mechanisms of ... different from that of GOX.OxidasesGOX (Monsanto)Early on, Monsanto Co. isolated glyphosate-AMPAbacteria from a glyphosate waste stream treatmentfacility. Achromobacter sp. LBAA was thus identifiedfor...
- 14
- 794
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... phytate with pH optima in theacidic range. They consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site atthe interface of the two domains [4,5]. HAPs can initi-ate ... substrate-freeAppA the C a atoms are 2.41 A ˚apart, whereas for thesubstrate-free PhyK and the substrate-loaded AppAthe averaged distance is only 1.87 A ˚.Distinct conformational changes ... unit.Single-wavelength anomalous diffraction data at the Seedge of a Mse-derivatized crystal of the same space groupand with similar cell dimensions were collected at BL 14-1at BESSY. Diffraction data from...
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt
... mitochondria with and without substrate. ProcNatl Acad Sci USA 90, 7523–7527.17 Ikeda Y & Tanaka K (1983) Purification and character-ization of isovaleryl coenzyme A dehydrogenase from rat liver ... 529–540.22 Shimomura Y, Honda T, Shiraki M, Murakami T,Sato J, Kobayashi H, Mawatari K, Obayashi M &Harris RA (2006) Branched-chain amino acidcatabolism in exercise and liver disease. J Nutr ... mm FAD and 0.1 mm acyl-CoA sub-strate. The final volume was 100 lL. The enzyme reactionwas carried out at 25 °C and the reaction was started with the addition of the acyl-CoA substrate. A reduction...
- 12
- 631
- 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc
... functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 ... and5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ (reverse) ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 (1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 (1)...
- 15
- 586
- 0
Tài liệu Báo cáo khoa học: Molecular determinants of ligand specificity in family 11 carbohydrate binding modules – an NMR, X-ray crystallography and computational chemistry approach doc
... Pedro Alexandrino Fernandes2,Jose´ A. M. Prates3, Carlos M. G. A. Fontes3, Marta Bruix4, Maria Joa˜o Roma˜o1, Ana Luı´saCarvalho1, Maria Joa˜o Ramos2, Anjos L. Macedo1and ... and that all the studied polysaccharides make sev-eral hydrogen bonds with the Asp99, Arg126, Asp128and Asp146 amino acids and, in the case of the largerligands, with Asp51 as well. Most of ... carbohydrate conformation. Proc Natl AcadSci U S A 98, 10541–10545.35 Basma M, Sundara S, Calgan D, Venali T & Woods RJ(2001) Solvated ensemble averaging in the calculation of partial atomic...
- 12
- 687
- 0
Tài liệu Báo cáo khoa học: Molecular aspects of rheumatoid arthritis: chemokines in the joints of patients pdf
... N,Kamogawa J, Yamamoto H, Takubo N, Nakata S,Yamada K, Yamamoto S et al. (2005) Accumulation of plasma cells expressing CXCR3 in the synovial sublin-ing regions of early rheumatoid arthritis in association with ... significantly elevated in RAsynovial fluid compared with synovial fluid from patients with OA or other forms of arthritis. The syno-vial fluid and peripheral blood of patients with RAcontain a greater ... T, Mizumura T,Ikari K, Kawaguchi Y, Takeuchi M, Kamatani N &Tomatsu T (2007) High CCL18 ⁄ PARC expression inarticular cartilage and synovial tissue of patients with rheumatoid arthritis....
- 8
- 652
- 0
Tài liệu Báo cáo khoa học: Molecular aspects of rheumatoid arthritis: role of environmental factors pdf
... mononu-clear cells, synovial fluid and saliva from RA patientsthan from controls and patients with other arthritides[16]. An EBV DNA quantification assay using real-timePCR revealed that the EBV DNA ... Shibata S, Munakata Y, IshiiT, Ishii K, Saitoh T, Sawai T, Sugamura K & Sasaki T(1998) Human parvovirus B19 as a causative agent forrheumatoid arthritis. Proc Natl Acad Sci U S A 95,8227–8232.8 ... 95,8227–8232.8 Kozireva SV, Zestkova JV, Mikazane HJ, Kadisa AL,Kakurina NA, Lejnieks AA, Danilane IN & MurovskaRole of environmental factors in RA S. Kobayashi et al.4460 FEBS Journal 275 (2008)...
- 7
- 462
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ