Báo cáo khoa học: Gc recruitment system incorporating a novel signal ampliﬁcation circuit to screen transient protein-protein interactions pot

... primers 5¢-AAATATAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢. The ﬁnal ratio of targetcells was determined by counting the number of coloniesretaining the target genes.AcknowledgementsThis ... as expected. These data indicate that transient interactions cannot be isolated in a library-based screen with the Gc recruitment system. Thus, anadvanced approach is required to screen transient interactions ... DiscussionDesign of a novel signal ampliﬁcation circuit to screen transient interacting protein pairsThe aim of this study was to establish and validate a screening method for weak and transient protein–pro-tein...

Báo cáo khoa học: "An Online System for Corpus Management and Analysis in Support of Computing in the Humanities" pot

... is the Storage Handler: Based on anautomatic mime type5detection it decides how to store and retrieve documents. For examplevideos and audio material are best stored as ﬁleswhereas XML documents ... tagger is a XML documentit is stored as a XML Database. Finally the in-formation about the new document is stored in theMaster Data including a reference to the originalone in order to state ... containers, sim-ilar to directories known from ﬁle systems. An im-portant addition is that resources can be memberof an arbitrary number of repositories. That way a document or a repository can...

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic and manual construction of sentiment corpora have been pro-posed. For example, Kim and ... senti-ment annotated corpus. To measure the reliability of the sentiment anno-tations, we conducted an inter-annotator agreement trial, with two annotators. This was performed based on the analysis ... in a Sentiment Annotated Corpus of Comments to Political debates Paula Carvalho Luís Sarmento University of Lisbon Labs Sapo UP & University of Porto Faculty of Sciences, LASIGE Faculty...

Báo cáo khoa học: Modiﬁed PCR methods for 3¢ end ampliﬁcation from serial analysis of gene expression (SAGE) tags doc

... small.Primers and linkersRT primer:5¢-(biotin)ATTGGCGCGCCGCGAGCACTGAGTCAATACGA(T)30VN-3¢rSAGER1: 5¢-GCGAGCACTGAGTCAATACGA-3¢rSAGEF1: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢TSP (tag-speciﬁc primer): ... oligo (dT)NVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTT16161616161616165′5′5′-cap oligoNVTTTTTTTNVTTTTTTTNBAAAAAAANVTTTTTTTGGGCCCGGGCCCGGGCCCGGGCCCGGGCCCAnneal ... primer:5¢-CCAGACACTATGCTCATACGACGCAG(T)16VN-3¢, where N = A, C, G or T, andV = A, G or C.5¢-cap oligonucleotide primer: 5¢-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3¢PLF: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢PLR: 5¢-CCAGACACTATGCTCATACGACG-3¢Tag-speciﬁc...

Báo cáo khoa học: Metal exchange in metallothioneins – a novel structurally signiﬁcant Cd5 species in the alpha domain of human metallothionein 1a ppt

... CA, USA), zincsulfate (Caledon Laboratory Chemicals, Georgetown,Canada), ammonium formate buffer (Sigma-Aldrich,Oakville, Canada), ammonium hydroxide (BDH Chemi-cals ⁄ VWR, Mississauga, Canada), ... divided by a factor of 33. UV spectra were acquiredusing a Cary 5G UV-Vis-NIR spectrophotometer (VarianCanada, Mississauga, Canada) in a 1 cm quartz cuvette atroom temperature (22 °C) and recorded ... protein.Cd2+was added incrementally to the solution of Zn4 a to 8.2 molar equivalents, with thorough mixing after eachtitration. Mass spectra were acquired at each addition after a 2–5 min delay to allow...

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the speciﬁc and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... Ikeda1, Shinya Kajita1, Masaya Nakamura2and Yoshihiro Katayama11Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, Koganei, Tokyo,Japan;2Forestry ... °C, b-aryl ether cleavage activity wasmeasured as described above.Localization of b-aryl ether cleavage activity A 14-day-old culture (4 mL) of 2BW-1 cells was separatedinto supernatant and ... ether cleavageactivity, we prepared a hyphae fraction (HP), an extracel-lular fraction (EC), a cytoplasmic fraction (CY) and a membrane fraction (M) from cultures of 2BW-1 (seeMaterials and methods)....

Báo cáo khoa học: "Fast Semantic Extraction Using a Novel Neural Network Architecture" docx

... solutions are compli-cated, consist of several stages and hand-built features, and are too slow to be appliedas part of real applications that require suchsemantic labels, partly because of ... is labeled foreach particular verb as so-called frames. Addition-ally, semantic roles can also be labeled with one of13 ARGM adjunct labels, such as ARGM-LOC orARGM-TMP for additional locational ... locational or temporalinformation relative to some verb.Shallow semantic parsing has immediate applica-tions in tasks such as meta-data extraction (e.g. fromweb documents) and question and answer...

Báo cáo khoa học: Crystal structure of RNase A tandem enzymes and their interaction with the cytosolic ribonuclease inhibitor potx

... cruciallimitation to the cytotoxicity of dimeric RNases.AbbreviationsBS-RNase, bovine seminal RNase; ds-RNase A, domain-swapped RNase A; FAM-AUAA-TAMRA, 6-carboxyﬂuorescein-dArU(dA)2-6-carboxytetramethylrhodamine; ... be active [48–69%,relative to monomeric RNase A, with RNA as sub-strate; 1–5%, relative to monomeric RNase A, with6-carboxyﬂuorescein-dArU(dA)2-6-carboxytetramethyl-rhodamine (FAM-AUAA-TAMRA) ... trypsin to about that ofRNase A (Table 1). From this activation, it can beunambiguously concluded that the RNase A entitieswithin the RATEs are catalytically active and that theactivity decrease...

Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc

... 5¢-GTGTAGCGCGCGTGCGGCCC-3¢. The forward and reverse primers, respectively,for CaS were 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and5¢-CAGTCGGAGCTAGGAAGGAA-3¢.Isolation of plasma membrane, intactchloroplasts, stroma ... thethylakoid membrane of Arabidopsis thalianaJulia P. Vainonen1, Yumiko Sakuragi2, Simon Stael1, Mikko Tikkanen1, Yagut Allahverdiyeva1,Virpi Paakkarinen1, Eveliina Aro1, Marjaana ... in cyanobacteria. According to hydropathyanalysis (tmhmm at http://www.cbs.dtu.dk and sosuiat http://www.bp.nuap.nagoya-u.ac.jp), CaS in higherplants has one transmembrane helix (amino acids...

Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

... 353AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTGCTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGAAGAATTCAAAGTCTGAAATTCGGGTTTGTATATAGGTACCTTAACCAGAATCAACTACTTTGTG 354ATATATGGATCCATGGGCTGGATTCCGTGTC ... H409LGGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC Y346FGTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC S17 7A CATATGTAGATGGAGCTGGAACTGTCCCTG D38 4A GGAGTGTCACTTAATGCACCCTTTGATGTTTG T35 2A 3754 A. Noiriel ... 358TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA 359ATCAACTACTTTGTGAGTCCATGATATGATTGATATGC 362GTGGCAATGGTAATCCAC 363Site-directed mutagenesisGCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ