Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx
... Journal of Science, Foreign Languages 26 (2010) 171-180 171 A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese ... the tones and intonation of the English language is presented. In Part IV, some aspects of intonation which are different in English and Vietnamese are addressed, and implications for teaching ... tones and intonation of the Vietnamese language. This lays the basis for comparing aspects of Vietnamese intonation with those of English intonation that follow. In Part III, an overview of...
- 10
- 1,968
- 17
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc
... 1 a1 ,3GalT-5¢-B and -Ep14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1 ,3GalT-5¢B and Ep15 ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1 ,3GalT-5¢-Cp16 AGGCAGGGCTGGGAGGAA Exon 3 a1 ,3GalT-5¢-Cp17 TTGCTGTCGGAAGATACATTGAG ... TCCTGAAACGCCTTCGGAAGAG E-selectinp10 CCATTGGGTTGAAGGCATTCG E-selectinp11 ACAAGGCCCCTGGCTGCT Exon 3 a1 ,3GalT-5¢ -A p12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1 ,3GalT-5¢ -A p13 CACTGTTCCCTCAGCCGAGGAC ... levels of 5¢ -A, 5¢-B and 5 ¢-C transcripts. Total a mount of a1 ,3GalT transcripts started to rise 2 h after the addition of TNFa, to reach a plateau after 4 h of activation (55%increase, to 1.8...
- 10
- 444
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... using the US manufactured de-vice and analyzed using the US-based software and New York data analysis center from pa-tients in the US, Germany, and Asia was completed. A total of 1076 patients from ... 2009.04.07 Abstract Background: Accurate, non-invasive diagnosis of, and screening for, coronary artery disease (CAD) and restenosis after coronary revascularization has been a challenge due to either ... MCG data and angiographic data. Fi-nally, microvascular disease, not associated with de-finable epicardial vessel lesions on angiography, re-sulting in myocardial ischemia can create a false...
- 13
- 684
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 ... CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...
- 16
- 646
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... inquiry.Education and educational researchWhat becomes obvious is that a lack of research hasimpact and implications for the education of both chiro-practors and medical physicians with regard to managingchest ... Chiropractic and medi-cal participants both noted lack of formal clinical studiesexamining effectiveness of manual/manipulativeapproaches to manage (diagnose and treat) musculoskel-etal chest pain, ... interprofessionalreferrals, that guidelines and care standards are an issue for all professions, that interactions between providers and professions (e.g. referrals) may also be standardized, and that 'best practices'...
- 10
- 788
- 0
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
... Australian and New Zealand Intensive Care Society Adult Patient Database; APD = Adult Patient Database; ARCCCR = Australian and New Zealand Intensive Care Society Research Centre for Critical Care ... incidence of in-hospital CAs in a number of single-centre before -and- after studies [5-9]. A ANZ = Australia and New Zealand; ANZICS = Australian and New Zealand Intensive Care Society; ANZICS-APD = Australian ... and rate of intensive care unit (ICU)admissions due to a ward cardiac arrest (CA) and ICUreadmissions.Methods We used the Australian and New Zealand IntensiveCare Society database to obtain...
- 8
- 639
- 0
Báo cáo y học: "Comparison of osteogenic potentials of human rat BMP4 and BMP6 gene therapy using [E1-] and [E1-,E2b-] adenoviral vectors"
... (Alk2, Alk3, and Alk6) and type 2 (BR2, ActR2, and ActR2B) receptors, activate the Smad and p38/MAPK signal transduction pathways, and, finally, activate transcription of bone formation factors ... Amalfitano A, Chamberlain JS. Isolation and characterization of packaging cell lines that coexpress the adenovirus E1, DNA polymerase, and preterminal proteins: implications for gene therapy. ... that are transgenic for an E1,E3–deleted adenoviral genome do not appear to tolerate first-generation adenoviral vectors, and exposure to adenoviral antigens still elicits the generation of...
- 9
- 501
- 0
Báo cáo y học: "Comparison of Classical and Clozapine Treatment on Schizophrenia Using Positive and Negative Syndrome Scale of Schizophrenia (PANSS) and SPECT Imaging"
... temporal and right anterior parietal, and also between the right caudate and right thalamus/basal ganglia. In addition, based on our study, positive symptoms have a strong correlation with paranoia, ... some areas like temporal and caudate, hyperfrontality was induced. Negative symptoms showed linkage to hypofrontality in both groups before and after treatment, and both positive and negative ... computers to acquire, process and display the SPECT image. As image processing software and hardware become smaller, faster and just "better", SPECT will adapt and incorporate those advances...
- 8
- 430
- 0
Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx
... uncoveredsome candidates, such as HLA class I histocompatibil-ity antigen A- 1 (HLA -A1 ), tapasin (TAPBP) and mito-chondrial solute carrier family 2 5A4 (SLC2 5A4 ), aspotential biomarkers for monitoring ... antigen; HLA -A1 , HLA class I histocompatibility antigen A- 1; iTRAQ, isobaric tags with related and absolute quantitation; SLC2 5A4 , mitochondrial solute carrier family 2 5A4 ; TAPBP, tapasin.3028 ... membrane associ-ated. Among these, 27% were shown to be in theplasma membrane, including CEACAM5, CEACAM6,VDAC1, VDAC3, isoform 1 of tapasin (TAPBP),SLC2 5A4 , HLA -A1 , CLDN3, ITGB2, Galectin-3 and keratin...
- 11
- 590
- 0
Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc
... Hungary2 Macromolecular Crystallography Laboratory, Center for Cancer Research, National Cancer Institute at Frederick, MD, USA3 Laboratory of Protein Dynamics and Signaling, Center for Cancer ... WG, Carrington JC, Cary SM & Parks TD(1988) Biochemical and mutational analysis of a plantvirus polyprotein cleavage site. EMBO J 7, 1281–1287.8 Carrington JC, Haldeman R, Dolja VV & ... substratemay partially compensate for the loss of the Lys sideTable 1. Comparison of the specificity of TEV and TVMV proteases. The relative specificity constants are given as values relative to...
- 10
- 523
- 0
Từ khóa: a cognitive model of semantic memory and its neural instantiationcase we send the a full window of size 7 and then wait for the acknowledgment of the whole window we need to send 1000 7 ª 143 windows we ignore the overhead due to the header and trailerthe rise of china soft power and its implications for the united statesmulti agent methods an example of an architecture and its application for the detection recognition and identification of targetsrapid soil drying and its implications for remote sensing of soil moisture and the surface energy fluxesa brief summary of previousa performance comparison of multihop wireless ad hoc network routing protocols pdfa brief history of the english civil war by john millera performance comparison of multi hop wireless ad hoc network routing protocols pdfbartolome de las casas a brief history of the destruction of the indiesa comparison of reading paper and online documentsa brief history of double entry bookkeeping bbca brief system of logickprovide a brief summary of the function of routing protocolsa performance comparison of multihop wireless ad hoc network routing protocolsBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP