Tài liệu Báo cáo khoa học: "Negative Polarity Licensing at t

Tài liệu Báo cáo khoa học: "Negative Polarity Licensing at the Syntax-Semantics Interface" doc

... the Uterals The final step in assembling the proof net is to con- nect together the literal nodes at the top of the graph. It is at this stage that unification is applied to the variables ... survive the hypothetical and so cannot affect the meaning of the licenser in some other way. That is, the licensing constructor (£ o (A ® l)) o B can derive all of the...

Ngày tải lên : 22/02/2014, 03:20

7
274
0

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE65a-His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. ... retinol (atROL) as the substrate for the conversion of 11cROL [24–27]; the substrate of RPE65 in the RPE is atRE [12]. To verify the substrate speciﬁcity of...

Ngày tải lên : 14/02/2014, 14:20

14
753
0

Tài liệu Báo cáo khoa học: Transient RNA–protein interactions in RNA folding docx

... represent the ﬂexible residues within the protein domain. NMR data provide evidence that the interaction site on the RNA is the phosphate backbone. This is also in accordance with the demonstrated ... assay, even at very low salt concentrations. As the latter assay would require the formation of a stable complex, the formation of only transiently populated RNAÆ protein com...

Ngày tải lên : 14/02/2014, 19:20

9
600
1

Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc

... MAPK-mediated phosphorylation of Bax at Thr167, leading to its activation in HepG2 cells [122]. On the other hand, treatment with OA increases Akt-mediated phosphorylation of Bax at Ser184, ... intri- cately interrelated; it was previously shown that either induction or inhibi- tion of phosphorylation causes cell death. Determination of the relationship between protein and phosphory...

Ngày tải lên : 14/02/2014, 22:20

15
784
0

Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

... hypothesize that the proton- ated state of the chaperone initiates this cycle, whereas the deprotonated state occurs upon completion of the maturation process of the partner. The nature of the signal ... from the heat of the reaction to obtain the effective heat of binding [27]. DSC Heat denaturation measurements were carried out on a MicroCal VP-DSC instrument (Microcal L...

Ngày tải lên : 16/02/2014, 14:20

10
685
0

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... within the GBD part of the protein. Another possible explanation for the observed autoinhibitory activity is that the Hth domain mediates some intramolecular interaction, or affects the conformation ... indicates the base that correlates with alternative or constitutive splicing. (B) The presence of alternative splicing around the 5¢-end of exon 6 of Meis2 and Meis3 was test...

Ngày tải lên : 16/02/2014, 15:20

14
753
0

Tài liệu Báo cáo khoa học: Steﬁn A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... that the cathepsin B mutations do not affect the geometry of binding of chagasin). The wild-type sequences have also been preserved in the related structural studies of procathepsin B [22]. These ... [19]. The mini loop in carboxypeptidase cathepsin X blocks the primed side of the active site, restricting access to only one residue [20]. Although the structures of the mature...

Ngày tải lên : 18/02/2014, 04:20

8
632
0

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... model dipalmitoylphosphatidylcholine bilayer in the presence of the 40-residue Ab peptide (Ab40). The simulated systems examine the effects of the insertion depth of the peptide, temperature, the protonation state ... salt concentration. Simulation set B examined the effects of both the protonation state of the peptide and temperature on the behavior of the system. Fin...

Ngày tải lên : 18/02/2014, 08:20

16
475
0

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... investigated the effects of the mutation on the enzymatic maturation of FVIIa and on the response of FVIIa to TF. Our measurements, in both the presence and absence of TF, revealed that the amidolytic ... effects of the G372(223)A mutation is slightly substrate-dependent. The fact that the relative reduc- tion in activity was not greater in the presence of cofactor strongl...

Ngày tải lên : 18/02/2014, 08:20

11
619
0

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... that they comple- ment each other. Other classification techniques Other classification techniques were investigated to evaluate whether they could add improvements to the new method. To further ... that look only at stability changes of the mutation compared with the wild-type protein [22,31]. Matthews’ correlation coefficient Matthews’ correlation coefficient (MCC) [37] was used to esti...

Ngày tải lên : 18/02/2014, 11:20

14
561
0