0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

... data(Utiyama and Isahara, 2003) as a gold standard. We segmentedall the Japanese data with the automatic segmenterJuman (Kurohashi and Nagao, 1994). There is a caveat to this evaluation, though. ... second alignment modelhas already received some attention, notably by(Yamada and Knight, 2001) and (Gildea, 2003) .2 Factor Graphs and Belief Propagation In this paper, we will make several use ... European Chapter of the ACL, pages 166–174,Athens, Greece, 30 March – 3 April 2009.c2009 Association for Computational LinguisticsAn Alignment Algorithm using Belief Propagation and a Structure-Based Distortion...
  • 9
  • 455
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Learning Word Senses With Feature Selection and Order Identification Capabilities" pdf

... have been presented, which can be cate-gorized as feature filter (Dash et al., 2002; Talav-era, 1999) and feature wrapper (Dy and Brodley,2000; Law et al., 2002; Mitra et al., 2002; Modha and ... feature space should be stable and robust against random sampling. After deter-mination of important contextual words, we use a Gaussian mixture model (GMM) based clustering algorithm (Bouman ... than CGDterm and CGDSV Difwe used average accuracy to evaluate their per-formance. Specifically, with χ2based featureranking, F SGMM attained 55.4% average accu-racy, while the best average...
  • 8
  • 463
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An Unsupervised Model for Joint Phrase Alignment and Extraction" ppt

... Och, and Daniel Marcu. 2003.Statistical phrase-based translation. In Proceedings ofthe Human Language Technology Conference (HLT-NAACL), pages 48–54.Philipp Koehn, Amittai Axelrod, Alexandra ... Computational Linguis-tics Annual Meeting (HLT-NAACL), pages 104–111.Daniel Marcu and William Wong. 2002. A phrase-based,joint probability model for statistical machine transla-tion. pages ... Alignment and ExtractionGraham Neubig1,2Taro Watanabe2, Eiichiro Sumita2, Shinsuke Mori1, Tatsuya Kawahara11Graduate School of Informatics, Kyoto UniversityYoshida Honmachi, Sakyo-ku,...
  • 10
  • 641
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) 2913–2926 ª 2011 The Authors Journal compilation ª 2011...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... An anthrax lethal factor mutant that is defective atcausing pyroptosis retains proapoptotic activityStephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy MogridgeDepartment of Laboratory ... inducing vascular leakage that leadsto shock and multiorgan failure [3–6]. The role ofLeTx in anthrax pathogenesis is complex, however, and probably involves the impairment of the innate and adaptive ... NS & Woude GF (2002) Apoptosis and melanogenesis in human melanoma cells induced byanthrax lethal factor inactivation of mitogen-activatedprotein kinase kinase. Proc Natl Acad Sci USA 99,3052–3057.21...
  • 9
  • 579
  • 0
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... isolated and purified using an Absolutely RNA kit(Agilent, Santa Clara, CA, USA). For quantitative RT-PCR,cDNA was generated using Superscript III (Invitrogen), and analyzed by PCR using a DNA engine ... intramolecular interactions, allowingaccess to the AD. As the autoinhibition affected anunrelated AD when this was put in place of the nativeMeis2d AD, it appears that any intramolecular interac-tions ... 5¢-GAGGTCGATGGGCATTTTC-3¢;Meis3-F, 5¢-GATGATCCAGCCATCCA-3¢; Meis3-R, 5¢-GGCTGGGTAGTCCTCGAAGT-3¢; mMeis3-F, 5¢-GTCCAGGCCATCCAGGTACT-3¢; and mMeis3-R, 5¢-TCCTCCCTGCAACTACCATC-3¢. The relative...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

... DNA sequences (PL DNAzyme, 5¢-GAATTCTAATACGACTCAGAATGAGTCTGGGCCTCTTTTTAAGAAC-3¢;8–17 variant DNAzyme, 5¢-AATACTCCGAGCCGGTCGGGCCTC-3¢; DRc DNAzyme, 5¢-GAATTCTAATACTCCGAGCCGGTCGGGCCTCTTTTTAAGAAC-3¢) ... 7.0)at 23 °C. The self-cleavage of DRc DNAzyme was A BCFEDFig. 3. Characterization of the DNA-cleaving and RNA-cleaving reactions catalyzed by DRc DNAzyme. (A C) Analyses of DNA cleavage at ... RNA substrate and RNase A can act as effectors to mediate the DNA cleavage. Our resultsshow that RNA-cleaving and DNA-cleaving activities simultaneously coex-ist in DRc DNAzyme, and the DNA...
  • 7
  • 601
  • 0
Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... growth factor-likepeptide regulates adult development of the silkmothBombyx moriNaoki Okamoto1, Naoki Yamanaka2,*, Honoo Satake3, Hironao Saegusa1,, Hiroshi Kataoka2 and Akira Mizoguchi11 ... consisting ofan A- chain and a B-chain, whereas IGFs are single-chain peptides with domains B, C, A and D, and themajor function of insulin is to control carbohydratemetabolism, whereas that of IGFs ... blotting was performed aspreviously described [39], using samples thus prepared. Theimmunoreactive band was detected using an ECL system(Amersham) and a Polaroid camera (Amersham).Purification...
  • 12
  • 707
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... 1-palmitoyl-2-oleyl-sn-glycero-3-phosphocholine(Avanti Polar Lipids Inc., Alabaster, AL, USA) at lipid-to-protein ratios of 0.5, 1.0 and 1.5 w ⁄ w. The mixture wasdialyzed in 50 lL buttons (Hampton Research, Aliso Viejo,CA, USA) against ... concentrate the c rings and to remove excess salt, thesample was loaded onto an Amicon Ultra-4 tube(30 000 Da molecular mass cut-off; Amicon, Hanover,Germany) and concentrated to about 2–4 ... source-depen-dent variation.Discussion A critical and long-standing question in (bacterial) bio-energetics is whether the ratio of translocated ions toATP for a given ATP synthase is a fixed value. Thisvalue...
  • 9
  • 773
  • 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... (GAPDH) mRNA quantification in coloncarcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthytissue counterparts ... of the mRNAs encompassingfull-length DAPK-1 and s-DAPK-1 in colorectal carci-nomas ( 1a) and their normal tissue counterpart ( 4a) using real-time PCR. As indicated, DAPK-1 and s-DAPK-1 seem ... s-DAPK-1Dtail was almost as active as full-length DAPK-1 (Fig. 4C). These data indicate that the‘tail’ of s-DAPK-1 has a negative regulatory functionwith regard to s-DAPK-1 activity, and that its...
  • 11
  • 659
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoatai lieu lop 5 khoa hoc bai an toan va tranh lang phi khi su dung dientai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop luctai lieu bao cao thuc tap nau anBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ