Tài liệu Báo cáo khoa học: "Generating and Visualizing a Soccer Knowledge Base" potx
Tài liệu Báo cáo khoa học: "Generating and Visualizing a Soccer Knowledge Base" potx
... Generating and Visualizing a Soccer Knowledge BasePaul Buitelaar, Thomas Eigner, Greg Gul-rajani, Alexander Schutz, Melanie Siegel,Nicolas WeberLanguage Technology Lab, DFKI GmbHSaarbrücken, ... and data already present in the corpus, the URLs ofall available data from the website are matchedagainst the IDs of the already extracted data.2.2 Linguistic Annotation and InformationExtractionAs ... 9thInternational Conference on applications of naturallanguage to information systems.Maedche, Alexander, Günter Neumann and SteffenStaab. 2002. Bootstrapping an Ontology-Based In-formation Extraction...
- 4
- 363
- 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx
... (ischemia) of key metaboliteconcentrations and metabolic fluxes,both measured and nonmeasured. A general parameter sensitivityanalysis is carried out to determine and characterize the parametershaving ... then glycerol, and finally acetateLogic sim NG NG Single time points of fluxes and mRNA measuredby microarraysAsenjo AJ, RamirezP, Rapaport I,Aracena J, Goles E& Andrews BA(2007) J MicrobiolBiotechnol ... Carbohydrate,pyruvateLactococcuslactisLactate dehydrogenase and NADPHoxidase have major control on thelactate flux. Experiments with lactatedehydrogenase knockout and NADPH oxidase overexpressingL....
- 91
- 733
- 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf
... might acetylate activegenes in association with the elongating Pol II. Inaddition to yeast SAGA and NuA4, the mammalianHAT HBO1 is also potentially able to be recruited to and to acetylate H4 ... [85]. Mast cells express GATA-2 as well asNFAT and AP-1, and GATA-2 initiates the formationof an additional discrete GATA-2 ⁄ AP-1 enhanceo-some-like complex existing upstream of the two NFA-T ... 1019–1031.131 Sharma GG, So S, Gupta A, Kumar R, Cayrou C,Avvakumov N, Bhadra U, Pandita RK, Porteus MH,Chen DJ et al. (2010) MOF and histone H4 acetyla-tion at lysine 16 are critical for DNA damage responseand...
- 29
- 743
- 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx
... miRNABrd-box: 5´ AGCUUUA |||||||dme-miR-4 3´ AGUUACCAACAGAUCGAAAUAdme-miR-79 3´ UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a 3´ CGAGUAGUUUCGACCGACACUAUdme-miR-2b ... UTR 5´ AUUGUUUUAUCUUAUCAGUAUUA ||| ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCC-GUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUsite 2: ZEB1 3´ UTR 5´ AUGCUAAAUCCGCUUCAGUAUUU ||||||| hsa-miR-200b ... AGUAGUAAUGGUCCGUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUTGF- s/BMPsR-smadspri-miR-21,19 9a pre-miR-21,19 9a DroshaDGCR8p68SignalMAPKKKERKmiR-21Spry1, 2 5´ CAUGUAAGUGCUUAAAUAAGCUA...
- 9
- 684
- 0
Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc
... Hoffman AE, Zheng T, Yi C, Leaderer D, Weidhaas J,Slack F, Zhang Y, Paranjape T & Zhu Y (2009) micr-oRNA miR-19 6a- 2 and breast cancer: a genetic and epi-genetic association study and functional ... matlab, version 201 1a (Mathworks, Natick, MA,USA), we compared localization and strand directionbetween miRNAs and transcripts (Refseq genes and mRNAs). Intragenic and intergenic miRNAs were definedby ... et al. (2004) Human microRNA genes arefrequently located at fragile sites and genomic regionsinvolved in cancers. Proc Natl Acad Sci USA 101,2999–3004.57 Takamizawa J, Konishi H, Yanagisawa...
- 12
- 636
- 0
Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt
... reticulumjunction, and are activated by membrane depolariza-tion. IcaLis important in heart function because itmodulates action potential shape and contributes topacemaker activities in the sinoatrial and ... 1944–1949.66 D’Alessandra Y, Devanna P, Limana F, Straino S, DiCarlo A, Brambilla PG, Rubino M, Carena MC,Spazzafumo L, De Simone M et al. (2010) CirculatingmicroRNAs are new and sensitive biomarkers ... the heart, and may be a potential anti-ar-rythmic target.Angiogenesis and vascular diseasesRecently, a few specific miRNAs that regulate endo-thelial cell functions and angiogenesis have beendescribed....
- 15
- 684
- 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 Department ... nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank underaccession numbers 2xog and 2xoiAbbreviationsPDB, Protein Data Bank; ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...
- 9
- 626
- 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc
... GCATCAACTTTCAAAAGATF127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACTRegulation ... AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG...
- 10
- 563
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... filter paper assay and tritium-labeledsubstrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. kcatwas calculated usingMw(HPRT) = 27132 Da and ... 6615–6627.24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthineguanine phosphoribosyltransferase expands substratespecificity. Arch Biochem Biophys...
- 11
- 770
- 0
Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc
... Ozawa Y, Nakamura T, Kamata N, Yasujima D,Urushiyama A, Yamakura F, Ohmori D & Imai T(2005) Thermococcus profundus 2-ketoisovalerateferredoxin oxidoreductase, a key enzyme in the archaealenergy-producing ... The assaymixture without NADH and acetyl-CoA was incubated at70 °C under an argon atmosphere. The reaction was startedby adding the NADH, acetyl-CoA and enzyme solutions tothe mixture, and ... lactate-dependent NADH oxidation as the decrease in A 340. The standard assay mixture contained 1 mm lactate,0.2 mm NADH and 1 mm fructose 1,6-bisphosphate (anallosteric effector of T. caldophilus...
- 10
- 619
- 1
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ