Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt

... TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" Aravind K. Joshi Dept. of Computer & Information Science University of ... this paper the functional uncertainty machinery in LFG is compared with the treatment of long distance dependencies in TAG. It is shown that the functional uncertainty machinery is redundant ... functional uncertainty, as defined by Kaplan and Zaenan [3] and Kaplan and Maxwell [2]. In this paper, we relate this characterization to that provided by Tree ~,djoining Grammars (TAG), showing...

Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

... alpha-Galac-tosidase A deﬁcient mice: a model of Fabry disease.Proc Natl Acad Sci USA 94 , 2540–2544.8 Chiba Y, Sakuraba H, Kotani M, Kase R, KobayashiK, Takeuchi M, Ogasawara S, Maruyama Y, NakajimaT, ... (d) portal vein endothelialVT1 cell staining. Most VT1 staining is lost after CsA treatment but portal triad staining was retained.MDR1 inhibition and GSL storage disease M. Mattocks et al.2070 ... mouseliver were reduced in ERT Fabry animals maintained a ABbdcFig. 3. Comparison of VT1 staining of wild-type and Fabrys kidney tissue. (A) VT1 staining of cryosections. (a, b) Fabry, (c, d) wild-type...

Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

... only minor confor-mational changes upon binding the twin-arginine signalpeptide of NapA [18]. In this case, biogenesis of theNapA protein is assisted by NapF in charge of cofactorloading [19,20]. ... interaction analysis evaluation software (BIAcore) tocalculate the kinetic constants of the complex formation.Molecular docking A molecular model of NarJT was obtained using modellersoftware. ... character of thebinding process predicted by ITC data.BIAcore surface plasmon resonance was used toinvestigate the kinetic parameters of the interaction (onrate constant kon and off rate...

Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efﬁcacy pdf

... carried out in binding buffer lacking ATP, and containing glucose and hexokinase without creatinephosphate or creatine kinase [34].Cell transfection and EGFP quantiﬁcationHuman lung carcinoma ... Effect of terminal and internal mismatches on siRNA–TRBP and siRNA–Dicer complexes. (A) EMSA of siRNA–TRBP and siRNA–Dicer complexes formed in H1299 cell extracts with siRNAs of varying terminal and ... TRBP and Dicerbinding and silencing efﬁcacyHemant K. Kini and S. P. WaltonApplied Biomolecular Engineering Laboratory ⁄ Cellular and Biomolecular Laboratory, Department of Chemical Engineering...

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-CCATGAAGTCCGCGAATC-3¢); and QsCgClp2 (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). Theabbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense and antisense primers. Accurate amplification of ... expression of Cg-Clp2 duringthis particular period is somewhat reminiscent of thefinding that certain mammalian CLPs such as CLP-1 and MGP40 are specifically expressed during mam-mary gland involution ... Takara, Mountain View, CA, USA). Double-stranded cDNA from oyster mantle edges was ligated toadaptors, and 25 ng of this template was used to PCRamplify 5¢- and 3¢-RACE fragments using adaptor-specificprimers...

Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

... B2-linker-ATTGTAACGGCTATATCTACTGGALR-c36SU3¢ B2-linker-GGCAAGAAGCTCGAAATAACCALR-c63SU3¢ B2-linker-CCAATAGCTGGCCAAGAACCALR-c96SU3¢ B2-linker-ATTCATACCGAAAAGACCC ALR2-HIS-f ATTTTTATGAGAAAACGTGAAAAAACTTCGTAATGTCGTCCTTATCGTACGCTGCAGGTCGACALR2-HIS-r ... ATTTTTATGAGAAAACGTGAAAAAACTTCGTAATGTCGTCCTTATCGTACGCTGCAGGTCGACALR2-HIS-r AAAGATCTGCCGACCTACCATAGCGGTCATGTTAATTGTAACGGCATCGATGAATTCGAGCTCGALR2-up TTCGAAAAATGCAGCATTHIS3-r TCTACAAAAGCCCTCCTACCD ALR2mutR-EforCCAGGAGAGAATTCAAGTATTGCALR2mutR-ErevGCAATACTTGAATTCTCTCCTGGALR2-5¢SacII-f ... CAGGGTATGGATGAAACGGTTGCAlr1-rtm TGATCCCGAAGTGGAAGTAGAGCAlr2-rtp TTAAGTTCTAATGCGAGGCCATCCAlr2-rtm TTCGTTCACTGTGCCTTTGATGGACT1_plus ACCAAGAGAGGTATCTTGACTTTACGACT1_minus GACATCGACATCACACTTCATGATGGOligomerization...

Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc

... (Genesearch, Arundel, QLD,Australia).Plasmids and cDNAsThe mammalian expression plasmid, pcDNA3 (Invitrogen,Melbourne, VIC, Australia), containing N-terminally ﬂag-tagged human Salvador (hSav) ... pro-apoptotic mammalian sterile20 kinases 1 and 2 (Mst1 and 2), and Salvador (Sav) has a human orthologue hSav (also called hWW45). Herewe show that Mst and hSav heterodimerize in an interaction ... that hSalvador can tightly interactwith the kinases Mst1 and Mst2, just as their counter-parts, Salvador and Hpo interact in Drosophila.ResultsMst kinase interacts with, and stabilizes,hSalvador...

Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx

... Gonza´lez Cappa SM, Katzin AM, An˜asco N & Lajma-novich S (1981) Comparative studies on infectivity and surface carbohydrates of several strains of Trypanosomacruzi. Medicina (B Aires) ... Aires, ArgentinaTrypanosoma cruzi, the etiological agent of Chagas’disease, is a parasitic protozoan with a digenetic lifecycle involving an insect vector and a mammalianhost. The parasite undergoes ... parasites harvested at the early logarithmicphase of growth, and ADC activity values are the average of assays carried out in duplicate. Transformed parasites were cultured in theabsence of...

Tài liệu Báo cáo khoa học: Bioinformatics of the glycoside hydrolase family 57 and identiﬁcation of catalytic residues in amylopullulanase from Thermococcus hydrothermalis doc

... (A) Q8TIT8_METAC AAM07401.1 378MA4052 (a- amylase) ND Methanosarcina acetivorans C 2A (A) Q8TIT9_METAC AAM07400.1 396MM0861 (a- amylase) ND Methanosarcina mazei Goe1 (A) Q8PYK0_METMA AAM30557.1 378MM0862 ... the distance betw een the pair of oxygen atoms of Glu123 and Asp214 is appropriate for retaining enzymes (less than 7 A ˚)[16], thus conﬁrming that GH-57 employs a retainingmechanism for a- glycosidic ... protein preparation and initial analysisMutation of residues Glu291 and Asp394 was performedusing t he QuikChange site-directed m utagenesis kit(Stratagene), the plasmid pAPU D2 [22,23] and appropriateoligonucleotides...

Tài liệu Báo cáo khoa học: "Demonstration of the UAM CorpusTool for text and image annotation" docx

... An important feature of the tool is that any change to the coding scheme is automatically propagated throughout all files annotated at this layer. For instance, if a feature is renamed in ... Window In the majority of cases, the annotator is interested in annotating a range of texts, not just single texts. Additionally, in most cases annotation at multiple linguistic levels is desired ... passive-clause in texts tagged as ‘english’ (this is thus a search over 3 annotation layers). Searches can also retrieve segments “containing” segments. One can also search for segments containing a...

Xem thêm