Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is speciﬁcally induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... The b-1,4-endogalactanase A gene from Aspergillus niger is speciﬁcally induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions Ronald ... consists of 99%D-galactose and 0.3%L -arabinose and is predominantly linear. Potatoarabinogalactan consists of 86%D-galactose and 6.6%L -arabinose, while soy arabinogalactan consists of ... listed in Materials and methods.Hydrolysis of arabinogalactans The sugar composition of the arabinogalactans from potato, onion and soy was determined as described [21].Onion arabinogalactan...

Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

... by centrifugation, and the supernatant was analyzed to determine its alanine contentby performing an alanine dehydrogenase assay [50]. The alanine content of assay mixtures was determined based ... that is highly similar to that of IscS(Fig. 1A) , with a two-domain organization and the presence of both a- helices and b-strands. On the basis of these data and the fact that alr2505-expression ... Latiﬁ A, Ruiz M, Jeanjean R & Zhang CC (2007)PrxQ -A, a member of the peroxiredoxin Q family, plays a major role in defense against oxidative stress in the cyanobacterium Anabaena sp. strain...

Tài liệu Báo cáo Y học: The glucose-speciﬁc carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

... thatdephosphorylation and/ or catalytic turnover of EIIGlc,rather than binding of Glc, enhanced the reactivity of Cys421. As Cys421 is the only invariant cysteine in homologous transporters and also the only ... binding and/ or translocation of substrates via the periplasmic site.EIIGlc is rapidly inactivated by the 6-O-bromoacetyl esters of methyl a- D-glucopyranoside ( 1a) andmethyla-D-manno-pyranoside ... methyl 6-deoxy-6-isothiocyanato -a- D-glucopyranoside (1e), b-D-glucopyranosyl isothiocyanate(3c)andb-D-glucopyranosyl phenyl isothiocyanate (3d).Phosphorylation of EIIGlcprotects, indicating...

Tài liệu Báo cáo Y học: The structures of the lipooligosaccharide and capsule polysaccharide of Campylobacter jejuni genome sequenced strain NCTC 11168 pdf

... Council of Canada, Ottawa, CanadaCampylobacter jejuni infections are one of the leading causes of human gastroenteritis and are suspected of being a pre-cursor to Guillain–Barre´ and Miller–Fisher ... missing in the latter [6].As already mentioned, the missing galactose can beattributed to the phase variability of wlaN. The lack of terminal GalNAc in this strain has recently been shown byGilbert ... As the absolute conﬁguration of the sugars was known from the chemical analysis, from a comparison of chemical shifts and coupling constants with those of monosaccharides,residue A was assigned...

Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

... the concentration of analyte, Rmax is the maximum analyte binding capacity in RU and R is the SPRsignal in RU at time t, k a the association rate constant and kd the dissociation rate constant.Using ... constant.Nonlinear regression analysis was used to determine the equilibrium dissociation constant from the sensorgrams and allows the calculation of both association and dissociationrate constants ... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGCHJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCCHJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGAHJ1 AGAAGCTCCATGTAGCAAGGCTAGHJ2...

Tài liệu Báo cáo Y học: The Ikaros family protein Eos associates with C-terminal-binding protein corepressors pptx

... histonedeacetylase activity and to perhaps function through a mechanism that depends on interactions with components of the basal transcriptional machinery such as TATAbinding protein and transcription ... shows that yeast har-bouring an expression vector encoding a Gal4 activationdomain–Eos-mut fusion and a Gal4 DNA-bindingdomain–CtBP fusion grow in the absence of histidine, and Fig. 2F indicates ... secondary antibody solution was added and incubation was continued for 1 h. The membrane waswashed for 1 h in several changes of Tris/NaCl/Tween.Detection was carried out using the RenaissanceÒ...

Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt

... membranes, and of causing the lysis of A. laidlawii B and human erythrocytes, are at least qualitatively correlated.As discussed earlier, GS10 and GS14 both exist in aqueous solution as antiparallel ... Dataacquisition and analysis was carried out usingMICROCALDA-2 (MicroCal LLC, Northampton, MA, USA) and ORIGIN software (OriginLab Corporation, Northampton,MA, USA). Samples containing the GS ring-size ... compare the relative antimicrobialpotencies of these three GS ring-size analogs against variousGram-positive and Gram-negative bacteria and against A. laidlawii, as the former types of bacteria...

Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

... methods. Enzyme activity was a nalysed by the standardassay and the i mmunoreactivity was detected by Western blot analysis and quantitated as described i n Materials and methods. Open and ﬁlled ... subtilases h ave about 20 aminoacids in this region and the large in sertion is a specialfeature of TPP II and pyrolysin [9,21]. There are, in total,12 amino -acid differences between the human and ... variants of TPP II ( i.e. rat,mouse, fruit y, Arabidopsis thaliana, Caenorhabdit is elegans and Schizosaccharo myces pombe), and at least three humanEST-clones covering this area (GenBank a...

Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

... resultsindicate that the increase in the afﬁnity of NK to chromatin is an ATP-dependent reaction, and is caused by a kinase(s) in the c ytosol. Then, authentic p rotein kinase A (PKA) and calmodulin-dependent ... N-terminal and arginine-serinerepeat-containing regions to chromatin was suppressed bymild trypsinization of the chromatin and by pretreatmentwith a DNA solution. A new cell-free system for analyzing the ... treated proteins w ere extracted with SDS and then analyzed bySDS/PAGE, followed by CBB staining and autoradiography. Lanes 1 and 4 , GST; lanes 2 and 5, GST–NK; l anes 3 and 6, GST– RS. The arrowhead...

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... electrophoretically to a poly(vinylidenediﬂuoride) membrane. The membrane was treated with a rabbit anti-iNOS polyclonal antibody or rabbit anti-PKCpolyclonal antibody at 1 : 1000 dilution and anti-(rabbitIgG) ... 378S–381S.7. Badamchian, M., Spangelo, B.L., Bao, Y. , Hagiwara, Y. ,Hagiwara, H., Ueyama, H. & Goldstein, A. L. (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulatesrelease ... horseradish peroxidase conjugated antibody at1 : 5000 dilution as a primary antibody and a secondaryantibody, respectively. The blots were detected with an enhanced chemiluminescence kit (Amersham...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học tài liệu báo cáo nghiên cứu khoa học tai lieu bao cao thuc tap y si da khoa tai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinh tai lieu bao cao thuc tap nganh the duc nghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vv báo cáo y học tài liệu báo cáo tài liệu báo cáo môn triết tài liệu báo cáo tài chính tài liệu di truyền y học tài liệu báo cáo môn báo cáo y học tài liệu báo cáo tài chính vốn bằng tiền tai doanh nghiệp tài liệu vi sinh y học Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ