0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 Silvia Villamarı´n1,*, Sylvia Mansilla1,*, Neus Ferrer-Miralles1, Waldemar Priebe2 and ... drugaccumulated in the cells. Despite the slow uptake rate, the antiproliferative capacity of WP631 (measured as IC50after a 72-h continuous treatment) was greater than that of daunorubicin. The propensities ... of Jurkat cells treated with a range of concentrations of daunorubicin or WP631 is illustrated inFig. 2. Data were obtained after 24 h (panels A and B) and 72 h (panels C and D). No significant...
  • 7
  • 581
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAGDeg RPE65-Rev AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev ... CTGAGGTTACAGACAACTGTTC13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011)...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

... Biochemistry,Department of Molecular Biosciences, The University of Adelaide;3Department of Medicine, The University of Adelaide,North Terrace, Adelaide, South Australia, AustraliaVascular endothelial ... Adamis, A. P. &D’Amore, P .A. (1996) The mouse gene for vascular endothelialgrowth factor: genomic structure, definition of the transcriptionalunit, and characterization of transcriptional ... Zhao, L. & Eghbali-Webb, M. (2001) Release of pro- and anti-angiogenic factors by human cardiac fibroblasts. Biochim. Bio-phys. Acta 1538, 273–282.10. Balasubramanian, S., Ramakrishnan,...
  • 13
  • 604
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: " A Refinement in Coding the Russian Cyrillic Alphabet" pdf

... forms of characters that do not occur initially; by disregarding the diacritic of the character ё, and by disregarding the character ё entirely. Ambiguities that arise in the latter cases can ... desirable if each character of the Russian alphabet (together with any re- quired numbers, punctuation marks and capitals) could be coded in such a way that a separate unique numerical code-word ... (iii) above, it can be seen that the problem of encoding ё and Ё is complicated by the source of the Russian language text. If e and ё are coded separately, it would appear that words containing...
  • 3
  • 369
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

... of matrix sparse-ness can be minimized by reducing the dimension-ality of the matrix. An appropriate algebraic method that has the capability to reduce the dimen-sionality of a rectangular ... the first split would be located between frond and the rest of the vocabulary. In the case of sake the beverage sense is extremely rare in the BNC and therefore was not represented among the ... our attention to the various species of ani-mals that are among the top 30 associations to poach. Some of them seem more often affected by cooking (pheasant, chicken, salmon), others by poaching...
  • 4
  • 536
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... the other hand, Pf and Rf express the quantitative status of the morphemes of each type as a mass in terminology. So the transi- tions of Pf and Rf, with changing N, express the changes of ... represent the distribution of population probabilities by means of G(p) with Z and to estimate the theoretical vocabu- lary size, and (ii) to interpolate and extrapolate V(N) and V(m, N) to the arbitrary ... kyo@rd.nacsis.ac.jp Abstract In this paper I will report the result of a quan- titative analysis of the dynamics of the con- stituent elements of Japanese terminology. In Japanese technical terms, the...
  • 7
  • 593
  • 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

... A point mutation in the ATP synthase of Rhodobacter capsulatusresults in differential contributions of DpH and Du in driving the ATP synthesis reactionPaola Turina and B. Andrea MelandriDepartment ... [34]) as a standard. The amounts of chromatophores and standard protein in the different lanes of a single gelwere kept in the linear range of the luminol assay response.Light-induced ATP synthesisLight-driven ... strain carried the deletion of the chromosomal atp2 operon and severalcopies of a plasmid carrying the mutated atp2 operon. As a control, a parallel at p2-deleted strain w as created, in whichthe...
  • 9
  • 580
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A module that computes coordinative ellipsis for language generators that don’t" pdf

... might‘Susi heard that Hans had an accident and might die’• Categorial (phrasal and lexical) nodes —bolded in Fig. 1 — carry reference tags (pre-sumably propagated from the generator’s strate-gic ... E.g., the tag “7” is attached to the root and head nodes of both exemplars of NPHans in Fig. 1, indicating their coreferentiality.For the sake of computational uniformity, wealso attach reference ... Within a clausal con-junct, all functions are represented at the samehierarchical level. Hence, the trees are “flat,” asillustrated in Fig. 1, and similar to the trees inGerman treebanks (NEGRA-II,...
  • 4
  • 456
  • 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... residues and a high abundance of aromatic residues that tend to be placed at the start of the strands [2,5]. These b-barrel proteinsare assembled in the bacterial outer membrane in a process mediated ... membrane, most of these mitochondrial pro-teins behave as if they have a- helical transmembrane domains, rather thanb-barrels. These proteins are usually predicted to have a single a- helicaltransmembrane ... compilation ª 2006 FEBS and alkali extraction might not always be a reliableindicator of whether a protein is integral in the outermembrane [17,20–22].As a distinct means to separate integral and...
  • 9
  • 554
  • 0
Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc

Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc

... quenched-flow analysis reveals that ChlH dramat-ically accelerates the formation and breakdown of an intermediate in the catalytic cycle of ChlM. In light of the profound effect that ChlH has on the methyltransferase ... a higheravailable concentration of ChlM to bind other mole-cular species in the reaction.ChlH appears to enhance catalysis by accelerating the formation and decay of a catalytic intermediate.This ... [15–20]. AsMgP is also the product of the magnesium chelatasereaction, this emphasizes the importance of quantita-tive studies not only of the methyltransferase and chelatase, but also of the interaction...
  • 8
  • 614
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ