Tài liệu Báo cáo khoa học: "Pseudo-Projectivity: A Polynomia

Tài liệu Báo cáo khoa học: "Online Large-Margin Training of Dependency Parsers" docx

... Crammer et al. (2003). Unlike the SVM parser of Yamada and Matsumoto (2003) and Ratna- parkhi’s parser, our parsers are trained to maximize the accuracy of the overall tree. Our approach is related ... per- forms as well or better than previous comparable systems, including that of Yamada and Matsumoto (2003). Their method has the potential advantage that SVM batch training takes into account...

Ngày tải lên : 20/02/2014, 15:20

8
443
0

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (TT...

Ngày tải lên : 15/02/2014, 01:20

13
641
0

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolved...

Ngày tải lên : 16/02/2014, 09:20

14
614
0

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mi...

Ngày tải lên : 18/02/2014, 14:20

9
457
0

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis in BJAB...

Ngày tải lên : 19/02/2014, 06:20

11
679
0

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was ampliﬁed with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...

Ngày tải lên : 19/02/2014, 12:20

11
566
0

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio- technology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-...

Ngày tải lên : 19/02/2014, 12:20

10
500
0

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker Vera Sheinman The Japan Institute for Educational Measurement Inc. 3-2-4 Kita-Aoyama, Tokyo, ... Lee and Seneff, 2008; Nagata et al., 2004; Nagata et al., 2005; Nagata et al., 2006; Tetreault et al., 2010b). This is one of the most active research areas in natural language processin...

Ngày tải lên : 20/02/2014, 04:20

10
467
0

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum- marization framework as well as a novel audiovisual presentation of art. MemeTube is designed as a ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptuall...

Ngày tải lên : 20/02/2014, 05:20

6
449
0

Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf

... each paid reward. • Qualifications To improve the data quality, a HIT can also be attached to certain tests, “qualifications” that are either system-provided or created by the requester. An example ... the assign- ments have been completed. • Rewards At upload time, each HIT has to be assigned a fixed reward, that cannot be changed later. Minimum reward is $0.01. Amazon.com collects a 10%...

Ngày tải lên : 20/02/2014, 09:20

9
610
1

Tài liệu Báo cáo khoa học: "Pseudo-Projectivity: A Polynomially Parsable Non-Projective Dependency Grammar" docx