Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reﬂection on some controversial features Elena Ghibaudi and Enzo Laurenti docx

... mechanism of lactoperoxidase and myeloperoxidase A reﬂection on some controversial features Elena Ghibaudi and Enzo Laurenti Dipartimento di Chimica I.F.M., Universita`di Torino, ItalyAlthough ... formulated a hypo-thesis that describes an integrated vision of the catalytic mechanism of both enzymes. The main points are: (a) a re-evaluation of the role of superoxide as a reductant in the catalytic ... of the samegroup. A survey of the available literature on their catalytic intermediates enabled us to ask some questions thatremained unanswered. These questions concern controver-sial features...

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

... ratios: at a 1 : 1 Fe2+⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disap-peared, and the resonance of Leu21 shifted. At a 2 : 1ratio, the resonances of residues 19 and 44 also ... spectrum of CyaY, but the most striking consequence of the addi-tion was the total disappearance of speciﬁc resonanceswithout the concomitant appearance of other signalsin other parts of the spectrum. ... peculiar. Being diamagnetic, the ionshould not cause paramagnetic shifts or inﬂuence the transversal relaxation. Conversely, two equivalents of the ion cause the shift and disappearance of severalsignals,...

Tài liệu Báo cáo khoa học: Probing the molecular determinants of aniline dioxygenase substrate speciﬁcity by saturation mutagenesis docx

... the V20 5A mutant (B) and WT AtdA3 (C). Alsoshown are the mononuclear iron (brownsphere) and the catalytic facial triad of H204, H209 and D356. (D,E) Molecular sur-faces of the substrate channel ... deletion assay, the atdA1 gene was amplified using the A1 _EcoRI_F and A1 _SalI_R primers. The atdA2 gene was amplified using the A2 _FseI_F and A2 _AvrII_R primers. The atdA3 gene wasamplified using the ... be a practical and valuable biocatalyst for the remediation of harmful aromatic amine contaminants.Aniline dioxygenase (AtdA) is a multicomponentenzyme isolated from Acinetobacter sp. strain...

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Deﬁnition" pptx

... pair similarity computation since the otherparts of speech (adjectives and adverbs) do not have a taxonomic representation structure. For example, the jcn similarity measure (Jiang and Conrath, ... [SE07], and Semcor.We tune the parameters in wmfvec and other base-lines based on SE2, and then directly apply the tunedmodels on other three data sets.Data: The sense inventory is WN3.0 for the ... data sets. WMF and LDA are built on the cor-pus of sense deﬁnitions of two dictionaries: WN and Wiktionary [Wik].2We do not link the senses acrossdictionaries, hence Wik is only used as augmenteddata...

Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx

... wereTable 3. Speciﬁcity of monoclonal anti-(human transcobalamin) sera and their effect on the functional properties of transcobalamin. nd, notdone.mAbEpitopeclusterPrecipitation of Apo-TC ... the maximalmAb ⁄ heparin effect on the functional activ-ity of TC. Arrows show the hypotheticalmovement of the domains after attachment of Cbl, see the main text.Mapping of transcobalamin ... Hewitt JE, Gordon MM, Taggart RT, Mohandas TK& Alpers DH (1991) Human gastric intrinsic factor:characterization of cDNA and genomic clones and localization to human chromosome 11. Genomics...

Tài liệu Báo cáo khoa học: "Understanding the Semantic Structure of Noun Phrase Queries" pptx

... domains, Movie, Job and National Park, and had them manually anno-tated. The annotation was given on both segmen-tation of the queries and classiﬁcation of the seg-ments according to the label ... taggedas Brand. In particular, Li et al. leveraged click-through data and a database to automatically de-rive training data for learning a CRF-based tagger.Manshadi and Li developed a hybrid, ... struc-tured and semi-structured data made available tosearch engines, such as relational databases and semantically annotated web documents. Search-ing over such data sources, in many cases, canoffer...

Tài liệu Báo cáo khoa học: "Identifying the Semantic Orientation of Foreign Words" pdf

... polar-ity. They assign any given word the label of its syn-onyms or the opposite label of its antonyms if any of them are known.Kanayama and Nasukawa (2006) used syntactic features and context ... construct a network of words using gloss deﬁnitions, thesaurus and co-occurrence statistics. They regard each word as anelectron. Each electron has a spin and each spin has a direction taking one of ... method is based on extracting all conjunctions of adjectives from a given corpus and then they classify each conjunc-tive expression as either the same orientation suchas “simple and well-received”...

Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx

... GCCCCATGGCGGTGGATGGCATATGGGAGGGGGTACCCPrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACCTCAAGCPrP113–231 CCAACCTCAAGCATATGGCAGGGPrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCCPrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCCPrPD112–136 CCAACCTCAAGCATGTGATGATCCATTTTGGCPrPD135–150 ... 112–136constitute part of the functional domain of the proteinprovides a plausible explanation for the high evolutionaryconservation of this region. Other research has shown the importance of this ... [66]. The importance of this region to the function of the protein explains its evolutionary conserva-tion. Conversion of this site to one that forms b-sheet and facilitates aggregation of the...

Tài liệu Báo cáo khoa học: "Selecting the “Right” Number of Senses Based on Clustering Criterion Functions" pdf

... 1 N , and then determines the mean and standard deviation of the criterion function. Then, a score is computed for each value of k by sub-tracting the mean from the criterion function, and dividing ... and the 6 sense noun line. We also created 19 nameconﬂations where sets of 2, 3, 4, and 6 names of persons, places, or organizations that are includedin the English GigaWord corpus (and that ... will have nobeneﬁt. If P K2 is greater than 1, then an addi-tional cluster improves the solution and we shouldincrease k. We compute the standard deviation of P K2 and use that to establish a...

Tài liệu Báo cáo khoa học: "Evaluating the Inferential Utility of Lexical-Semantic Resources" ppt

... 2007; Kazama and Tori-sawa, 2007).As of today, only a partial comparative pictureis available regarding the actual utility and limi-tations of available resources for lexical-semanticinference. ... inference, are commonly utilized by ap-plied inference systems (Giampiccolo et al., 2007) and applications such as Information Retrieval and Question Answering (Shah and Croft, 2004; Pasca and Harabagiu, ... example, the retrieved texts contain lake and pollution but donot contain water.4) Annotation: A sample of the retrieved textsis presented to human annotators. The annotatorsare asked to answer...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam