Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Deﬁnition" pptx

... pair similarity computation since the otherparts of speech (adjectives and adverbs) do not have a taxonomic representation structure. For example, the jcn similarity measure (Jiang and Conrath, ... inancial topic inbank#n#1 and stock#n#1) without further dis-cernibility. In this case, many senses will share the same latent semantics proﬁle, as long as they are in the same topic/domain.To ... WN:bank#n#1: a ﬁnancial institution that accepts depositsand channels the money into lending activitiesstock#n#1: the capital raised by a corporation through the issue of shares entitling holders to an...

Tài liệu Báo cáo khoa học: "Learning the Fine-Grained Information Status of Discourse Entities" pptx

... Computational Natural Language Learn-ing: Shared Task, pages 28–34.Malvina Nissim, Shipra Dingare, Jean Carletta, andMark Steedman. 2004. An annotation scheme forinformation status in dialogue. ... evaluate the rule-based approach and the learning-based approach to determining the ISsubtype of each hand-annotated NP in the test set.Classiﬁcation results. Table 3 shows the results of the ... neither of them belongsto any chains. As a result, when gold chains areused, Rule 1 will classify all occurrences of “you”that are not part of a chain as old/general, regard-less of whether...

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

... of the addi-tion was the total disappearance of speciﬁc resonanceswithout the concomitant appearance of other signalsin other parts of the spectrum. This result could be a consequence of the ... protein ratio, the resonances of Arg20, Asp22 and Asp23 disap-peared, and the resonance of Leu21 shifted. At a 2 : 1ratio, the resonances of residues 19 and 44 also disap-peared, whereas those of ... Gakh O, Park S, Ryde U,Lindahl M, Leath K, Garman E, Isaya G & Al-Kara-daghi S (2006) The structures of frataxin oligomersreveal the mechanism for the delivery and detoxiﬁcation of iron....

Tài liệu Báo cáo khoa học: Probing the molecular determinants of aniline dioxygenase substrate speciﬁcity by saturation mutagenesis docx

... and pET A3 A 4A5 –atdA2 pACYC A1 and pET A3 A 4A5 +atdA3 pACYC A1 A2 and pET A4 A5 –Control (no deletion) pACYC A1 A2 and pET A3 A 4A5 +E. L. Ang et al. Substrate specificity of aniline dioxygenaseFEBS ... and A1 _SalI_R primers. The atdA2 gene was amplified using the A2 _FseI_F and A2 _AvrII_R primers. The atdA3 gene wasamplified using the A3 _EcoRI_F and A3 _SalI_R primers. The atdA 4A5 gene was amplified ... Urbana-Champaign, Urbana, IL, USA5 Department of Chemistry, University of Illinois at Urbana-Champaign, Urbana, IL, USAAniline and its derivatives are widely used as inter-mediates in the pharmaceutical...

Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx

... maximalmAb ⁄ heparin effect on the functional activ-ity of TC. Arrows show the hypotheticalmovement of the domains after attachment of Cbl, see the main text.Mapping of transcobalamin using antibodies ... Geremia S &Randaccio L (2001) Crystallization and preliminaryX-ray diffraction analysis of human transcobalamin, a vitamin B12-transporting protein. Acta Crystallogr D57,1890–1892.16 Quadros ... supernatant were separated using a magnet, and the radioactivity in each fraction was deter-mined.Binding of mAbs to peptide fragments generatedby CNBr treatmentRecombinant human TC from yeast was...

Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reﬂection on some controversial features Elena Ghibaudi and Enzo Laurenti docx

... formulated a hypo-thesis that describes an integrated vision of the catalyticmechanism of both enzymes. The main points are: (a) a re-evaluation of the role of superoxide as a reductant in the catalytic ... highlights the presence of mutual chemical interactions between enzyme intermedi-ates and provides and explanation for catalase activity.Other questions, such as the localization of the aminoacid radical ... (ordo mammalian peroxidases possess catalase activity); (b)does Cpd I exist in two isomeric forms, containing the porphyrin radical and the amino acid radical (aa+•),respectively; (c) as the...

Tài liệu Báo cáo khoa học: "Understanding the Semantic Structure of Noun Phrase Queries" pptx

... semi-structured data made available tosearch engines, such as relational databases andsemantically annotated web documents. Search-ing over such data sources, in many cases, canoffer more relevant and ... particular, Li et al. leveraged click-through data and a database to automatically de-rive training data for learning a CRF-based tagger.Manshadi and Li developed a hybrid, generativegrammar model ... is a list of employee namesextracted from a job listing database. Note that a substantial amount of research effort has beendedicated to automatic lexicon acquisition from the Web (Pantel and...

Tài liệu Báo cáo khoa học: "Identifying the Semantic Orientation of Foreign Words" pdf

... or the opposite label of its antonyms if any of them are known.Kanayama and Nasukawa (2006) used syntacticfeatures and context coherency, deﬁned as the ten-dency for same polarities to appear ... LinguisticsIdentifying the Semantic Orientation of Foreign WordsAhmed HassanEECS DepartmentUniversity of MichiganAnn Arbor, MIhassanam@umich.eduAmjad Abu-JbaraEECS DepartmentUniversity of MichiganAnn Arbor, ... 2006. Arabic wordnet and the challenges of arabic. In Arabic NLP/MT Confer-ence.Ahmed Hassan and Dragomir Radev. 2010. Identifyingtext polarity using random walks. In ACL’10.Ahmed Hassan, Vahed...

Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx

... GCCCCATGGCGGTGGATGGCATATGGGAGGGGGTACCCPrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACCTCAAGCPrP113–231 CCAACCTCAAGCATATGGCAGGGPrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCCPrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCCPrPD112–136 ... disease termed prion diseases [1,2]make up a small percentage of all human neurodegenerativediseases. Prion diseases have become a major concernbecause of the possibility that one particular from, ... antibodies have been mapped and are listed inTable 2. The activity of wild-type PrP is like that of a SODand this activity can be measured by a number of assays. The most robust and accessible...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... SDS/PAGE gave a singleband at apparent molecular mass of 34 kDa. The binding affinity of the lectin in the hemolymph of the freshwater crab, Paratelphusa jacquemontii, expressedO-acetyl sialic acid ... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crabParatelphusa jacquemontiiMaghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. Jeya SuriyaDepartment ... [34]. An evaluation of the literature revealed that purification of lectin from the hemolymph of crustaceans was most successful by affinitychromatography as it gave a higher fold of purification andpercentage...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học cac tai lieu ngien cuu khoa hoc cua the gioi tai lieu bao cao thuc tap nganh the duc bài 7 theo tài liệu báo cáo kết quả kinh doanh về sản phẩm a của công ty ab trong năm 2005 như sau tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị 10 trần thị luyến và cộng sự hoàn thiện quy trình sản xuất chitin chitosan và chế biến một số sản phẩm công nghiệp từ phế liệu vỏ tôm cua báo cáo khoa học đề tài cấp bộ nha trang 2000 nghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vv báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien tai lieu bao cao thuc tap y si da khoa báo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pot Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ