Tài liệu Báo cáo khoa học: Novel aggregate formation of a fr

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrine Rev 15, 439–461. K. Komaru et al. Novel aggregate formation of an alkaline phosphatase frame-shift mutant FEBS ... Journal 272 (2005) 1704–1717 ª 2005 FEBS 1717 Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosp...

Ngày tải lên : 19/02/2014, 17:20

14
445
0

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... (e.g. The Minister of Finance is done!). There are also cases wherein the opinion is targeting another commentator (e.g. Mr. Francisco de Amarante, did you watch the same debate I did?!?!?), and ... prime the later achieved the lowest percentage of votes in the 2009 parliamentary election. Fig. 2 . Polarity distribution per candidate Also interesting is the...

Ngày tải lên : 20/02/2014, 05:20

5
499
0

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... the transforming factor heregulin leads to increases in the levels of HSF1 and MTA1 (a component of the NuRD complex containing HDAC1 and HDAC2) proteins and to binding of HSF1 to MTA1 [78]. The ... stress, is involved in the activation and inactivation of the transactivating ability [26]. Interestingly, Saccharomyces HSF is unu- sual among transcriptional a...

Ngày tải lên : 18/02/2014, 04:20

10
565
0

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain Thirumaran Thanabalu 1,2 , Rajamuthiah Rajmohan 2 , Lei Meng 2 , Gang Ren 4,5 , Parimala R. Vajjhala 4 and Alan L. Munn 1,3,4,6 * 1 ... for actin-cytoskeleton polarization: a novel C-terminal actin-binding submod- ule (CABS) that contains a novel G-actin-binding domain, which we call a verprolin h...

Ngày tải lên : 18/02/2014, 16:20

23
679
0

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. ... retinal (atRAL) by a photon induces a conformation change of the visual pigments, triggers the phototransduction cascade and initiates vision [1,2]. The...

Ngày tải lên : 14/02/2014, 14:20

14
753
0

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... T-cell kinase (ITK) could in uence the infectivity of HIV and also have anti -in ammatory activity. Since 2006, several patients carry- ing a fusion protein, originating from a translocation joining ... domain; arginine 28 is in dark blue, encircled in red. Bottom left: SH2 domain. Right: kinase domain. The mutated residues are indicated in yellow, a- helices are in c...

Ngày tải lên : 14/02/2014, 18:20

10
926
0

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... in various organ systems. Even in organisms lacking a brain, such as Caenorhabditis elegans, the nervous system plays a key role in maintaining energy balance [1–4]. In more advanced, mammalian ... higher organisms, this involves storing energy as fat during periods of an abundant food supply to hedge against periods of food shortage. Today, humans have pushed storage too...

Ngày tải lên : 14/02/2014, 22:20

7
678
0

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... key regulator of cell survival [12]. Maintaining the balance between cell survival and apoptosis is critical in the maintenance of a healthy organism, and tipping the equilibrium in one or another ... through the mitochondrial pathway. The key event in the mitochondrial pathway is the release of proapoptotic factors from the mitochondrial intermembrane sp...

Ngày tải lên : 16/02/2014, 09:20

12
718
0

Tài liệu Báo cáo khoa học: Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? docx

... information The following supplementary material is available: Fig. S1. MALDI-TOF MS analysis of 17 amino acid peptides after incubation with anSMEcpe. Fig. S2. MALDI-TOF MS analysis of 17C and ... conditions [12]. In the absence of substrate, the AdoMet reductive cleavage activity of all mutants was identical to that obtained in the presence of peptide, again indica...

Ngày tải lên : 16/02/2014, 14:20

15
559
0

Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

... Ltd. The targeting sequence of the siRNA against rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT-3¢. A negative control adenovirus vector containing nonspeciﬁc siRNA was constructed in the same way (non- speciﬁc ... protein 1 (TRAP1) is a mitochondrial chaperone that plays a role in maintaining mitochondrial function and regulating cell apoptosis. The opening of the mito...

Ngày tải lên : 16/02/2014, 14:20

10
507
0