Tài liệu Báo cáo khoa học: A second independent resistance mechanism to Bacillus sphaericus binary toxin targets its a-glucosidase receptor in Culex quinquefasciatus docx

... independent resistance mechanism to Bacillus sphaericus binary toxin targets its a- glucosidase receptor in Culex quinquefasciatus Tatiany Patrıćia Romaõ1, Karlos Diogo de Melo Chalegre1, Shana ... (primer 3, GAAAAGCTTCAGCTGGAAGTTGAACGGCAT; primer 4, AACAAGCTTCACGAAATCTCCCAGGTCCAC; primer 7, AACAAGCTTGAAATCTCCCAGGTCCACGGT) were used. To facilitatecloning of the amplified fragments, primers ... Cam-paign against Culex quinquefasciatus using Bacillus sphaericus: results of a pilot project in a large urbanarea of equatorial Africa. Bull World Health Organ 71,367–375.2 Kumar A, Sharma...

Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx

... serving as molecular standards (Amersham Bio-science).Analysis of the N-terminal amino-acid sequencesThe N-terminal amino-acid sequences of the enzymes wereanalyzed using an automated Edman ... Sakuraba H, Takamatsu Y, Satomura T, Kawakami R& Ohshima T (2001) Puriﬁcation, characterization, andapplication of a novel dye-linked l-proline dehydrogen-ase from a hyperthermophilic archaeon, ... kbp) andpPDH2 containing the PDH2 gene (insert length; 7.4kbp), to be obtained and used as templates for DNAR. Kawakami et al. FAD, FMN and ATP-containing amino-acid dehydrogenaseFEBS Journal...

Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx

... Arabidopsis and barley cDNA encod-ing HAK potassium transporters in root and shootcells. Physiol Plant 109, 34–43.50 Shabala L, Cuin TA, Newman IA & Shabala S (2005)Salinity-induced ion ﬂux patterns ... functional analysis ofplant DEVH box RNA helicases, and suggest that AtHELPS, as an impor-tant negative regulator, plays a role in K+deprivation stress.AbbreviationsABA, abscisic acid; FW, ... 2-week-oldpAtHELPS:GUS and 35S::GUS transgenic seedlings are shown. The average GUS activity was obtained from at least ﬁve independent trans-formants, and each assay was repeated three times. Standard errors are...

Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc

... model was validated in vitro andusedtoexaminethe branch-point kinetics in detail and to obtain insights intothe kinetic controls of methionine and threonine synthesis in plants.The branch-point ... RJI¼ a means that a 1% change in I around a givenvalue promotes an a percent change in ﬂux J. A negative value meansthat input variable and ﬂux vary in opposite directions.Inputvariable(I)Input ... 2003 An Arabidopsis phosphohomoserine branch-point model (Eur. J. Biochem. 270) 4625the aspartate-derived amino-acids pathway and aromaticamino-acids pathway in plant and in microorganisms aresuch...

Tài liệu Báo cáo khoa học: "A Novel Feature-based Approach to Chinese Entity Relation Extraction" ppt

... least at current stage. In this paper, we study a feature-based approach that basically integrates entity related information with context information. 3.1 Classification Features The classification ... extraction drives us to investigate how to find an approach that is particularly appropriate for Chinese. 3 A Chinese Relation Extraction Model Due to the aforementioned reasons, entity relation ... ORG_AFF.INVESTOR/SHARE, …Table 1 Possible Relations between ARG-1 and ARG-2 Since our classifiers are trained on relations instead of arguments, we simply select the first (as in adjacent and...

Tài liệu Báo cáo khoa học: "A Logic-based Semantic Approach to Recognizing Textual Entailment" ppt

... Textual EntailmentMarta Tatu and Dan MoldovanLanguage Computer CorporationRichardson, Texas, 75080United States of Americamarta,moldovan@languagecomputer.comAbstractThis paper proposes a ... lexical chainsby limiting the path length to three relations andthe set of WordNet relations used to create thechains by discarding the paths that contain certainrelations in a particular order. ... numberclose to 0 indicating a probable negative example and a num-ber close to 1 indicating a probable positive example. Eachpair’s lexical alignment score, , is thenormalized average edit distance...

Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

... multimodal grammar template and any available corpus training data to build a multimo-dal understanding model and speech recognition language model. The user interacts with the multimodal user in- terface ... speech and handwriting, the in- terface also supports more traditional graphical user interface (GUI) commands. In the details panel, the actors and directors are presented as but-tons. Pointing ... Pointing at (i.e., clicking on) these buttons results in a search for all of the movies with that particular actor or director, allowing users to quickly navigate from an actor or director in a spe-cific...

Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

... modiﬁcation; TAA, tumor-associated antigen; tPA, tissue-type plasminogen activator; uPA, urokinase-type plasminogen activator;uPAR, urokinase-type plasminogen activator receptor. 1064 FEBS Journal 278 ... A, Milella M et al. (2009) An integratedhumoral and cellular response is elicited in pancreaticcancer by alpha-enolase, a novel pancreatic ductaladenocarcinoma-associated antigen. Int J Cancer ... Hamaguchi T, Iizuka N, Tsunedomi R, Hamamoto Y,Miyamoto T, Iida M, Tokuhisa Y, Sakamoto K, Taka-shima M, Tamesa T et al. (2008) Glycolysis moduleactivated by hypoxia-inducible factor 1alpha...

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... (2010) Mathematical model-ling of the central carbohydrate metabolism in Arabid-opsis thaliana reveals a substantial regulatory in uenceof vacuolar invertase on whole plant carbon metabo-lism. ... dynamics during acclimation to lowtemperature in Arabidopsis thalianaThomas Na¨gele, Benjamin A. Kandel*, Sabine Frana*, Meike Meißner and Arnd G. HeyerBiologisches Institut, Abteilung Pﬂanzenbiotechnologie, ... high-performanceanion exchange chromatography (HPAEC) with a Carb-oPac PA-1 column on a Dionex (Sunnyvale, CA, USA)T. Na¨gele et al. Systems biology of cold acclimation in A. thalianaFEBS Journal...

Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

... multi-stage tandem MS.AbbreviationsAAL, Aleuria aurantia lectin; AFP, a- fetoprotein; GGDB, GlycoGene Database; GlycoProtDB, GlycoProtein Database; GMDB, Glycan MassSpectral Database; HCC, hepatocellular ... a common glycome, arguing for a commonorigin. Nat Chem Biol 5, 244–250.16 Kuno A, Itakura Y, Toyoda M, Takahashi Y, YamadaM, Umezawa A & Hirabayashi J (2008) Developmentof a data-mining ... using lectin-mediated afﬁnity capture and glycosyl-ation site-speciﬁc stable isotope tagging. Nat Protocols1, 3019–3027.21 Natsume T, Yamauchi Y, Nakayama H, Shinkawa T,Yanagida M, Takahashi...

Xem thêm