Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

... asialoglycoprotein receptor; CHO, Chinese hamster ovary; ER, endoplasmic reticulum; HCV, hepatitis C virus; HCVpp, HCV pseudotyped particles; HCVcc, cell culture-derived HCV particles; HDL, high-density ... response during acute and chronic hepatitis C virus infection. Proc Natl Acad Sci USA 101, 10149–10154. 52 Flint M, Logvinoff C, Rice CM & McKeating JA (2004) Characterizat...
Ngày tải lên : 19/02/2014, 06:20
  • 15
  • 570
  • 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... from the C- terminal domain were as follows: 2FIRREV, 5¢- CCNCKNABRAAMANATCCT GTCC-3¢; CTERMREV, 5¢-TCNGCNCCRTACCARTC-3¢. Fig. 3. Molecular dynamics simulations. Ribbon representation of Ca chain ... frequently adjacent (six occurrences) or at close proximity (12 occurrences) in the sequences. Both properties should result in strong electrostatic repulsions, promoting an extended confor- mat...
Ngày tải lên : 14/02/2014, 18:20
  • 8
  • 624
  • 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ClaI restriction site at nucleotide position –6 and a reverse primer (5 ¢-A TCGCCATGGTC CCGGGCATATGGGATCCCTGGAAGTACAGGTTTT CGCCATGCTCTTGATCCC-3¢) ... (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was designed to insert a ClaI restric- tion site at nucleotide position )6, whereas...
Ngày tải lên : 18/02/2014, 04:20
  • 14
  • 672
  • 0
Tài liệu Báo cáo khoa học: "How Phrasing Affects Memorability" ppt

Tài liệu Báo cáo khoa học: "How Phrasing Affects Memorability" ppt

... Lee Department of Computer Science Cornell University cristian@cs.cornell.edu, jc882@cornell.edu, kleinber@cs.cornell.edu, llee@cs.cornell.edu Abstract Understanding the ways in which information achieves ... are consistent with memorable text. The fact that it’s not clear how to construct a col- lection of “non-memorable” counterparts to slogans appears to pose a technical challenge. Howev...
Ngày tải lên : 19/02/2014, 19:20
  • 10
  • 426
  • 0
Tài liệu Báo cáo khoa học: "How Are Spelling Errors Generated and Corrected? " docx

Tài liệu Báo cáo khoa học: "How Are Spelling Errors Generated and Corrected? " docx

... steps (Cf. Figure 1): • To recover the post-correction string, we deleted the same number of characters preced- ing a sequence of backspace keys. • To recover the pre-correction string, we com- pared ... Trans- position Vowel / Consonant Insertion Inserted Character 0.0 0.4 0.8 C > ;C C−>V V−> ;C V−>V Substitution Substituted Character −> Correct Character en_keystroke ja_keys...
Ngày tải lên : 19/02/2014, 19:20
  • 5
  • 420
  • 0
Tài liệu Báo cáo khoa học: "How spoken language corpora can refine current speech motor training methodologies" pptx

Tài liệu Báo cáo khoa học: "How spoken language corpora can refine current speech motor training methodologies" pptx

... recorded its structure, frequency rank, and the articulatory characteristics of its consonants. Next, we describe the speech items selection tool for clinicians. Figure 1: Syllable frequency ... Spoken Dutch Corpus (CGN). All the resources included manually verified syllabification transcriptions. A 10-fold cross validation on each of the corpora was performed to evaluate the accuracy of our .....
Ngày tải lên : 20/02/2014, 04:20
  • 6
  • 387
  • 0
Tài liệu Báo cáo khoa học: "HOW DO WE COUNT? THE PROBLEM OF TAGGING PHRASAL VERBS IN PARTS" docx

Tài liệu Báo cáo khoa học: "HOW DO WE COUNT? THE PROBLEM OF TAGGING PHRASAL VERBS IN PARTS" docx

... nava@nynexst.com ABSTRACT This paper examines the current performance of the stochastic tagger PARTS (Church 88) in handling phrasal verbs, describes a problem that arises from the statis- tical ... average perfor- mance of the tagger as claimed in Church 88. Yet we notice that simply assigning a verbal tag to all pairs ac- tually degrades performance because in some cases the conte...
Ngày tải lên : 20/02/2014, 21:20
  • 3
  • 516
  • 1
Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

... response (i.e. occurring when all receptor sites are occupied) that will be approached by a speci c analyte concentration specified by the K D of the receptor–ana- lyte interaction. This was clearly not ... Clinical Chemistry Section, Department of Morphological-Biomedical Sciences, University Hospital of Verona, Italy Introduction Protein C is a vitamin K-dependent c- carboxyglutamic acid...
Ngày tải lên : 18/02/2014, 06:20
  • 17
  • 495
  • 0
Tài liệu Báo cáo khoa học: The cartilage-specific transcription factor Sox9 regulates AP-2e expression in chondrocytes pptx

Tài liệu Báo cáo khoa học: The cartilage-specific transcription factor Sox9 regulates AP-2e expression in chondrocytes pptx

... mutSox9-447_for, 5¢-CCAGAAGGCGGCTCT GATTGCTGTGGGCTGAATTCACGC-3¢; and mutSox9- 447_rev, 5¢-GCGTGAATTCAGCCCACAGCAATCAGAG CCGCCTTCTGG-3¢. A K. Bosserhoff et al. Sox9 regulates AP-2e in hypertrophic chondrocytes FEBS ... performed using speci c primers: AP-2e-for, 5¢-GAAATAGGGACTTAGCTCTTG G-3¢, and AP-2e-rev, 5¢-CCAAGCCAGATCCCCAACT CTG-3¢ (annealing temperature 59 ° C) ; AP-2a-for, 5¢-GAT CCTCG...
Ngày tải lên : 18/02/2014, 08:20
  • 11
  • 605
  • 0

Xem thêm

Từ khóa: