0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme Tomohiko Gohya1, Xuhong Zhang2, Tadashi Yoshida2 and Catharina T. ... at the same time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The ... estimated directly from the values of absorbance at these maxima (data notshown). The estimated association constants for imi-dazole and azide binding to heme GmHO-1 are sum-marized and compared...
  • 16
  • 617
  • 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... 5¢-GAGCCAACAGAAGTTTGCTTCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 ( 1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 ... containing PHD domain;unknown functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 ( 1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040...
  • 15
  • 586
  • 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed ... Wellenreuther and W. Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data ... coordi-nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or anaspartate. The apparent conflict of this finding with the absence of a coordinating carboxylate...
  • 15
  • 624
  • 0
Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

... 0.01Æmin )1 ) the chase are the average of two independentassays. All data points between the two independent assays have a standard deviation < 10%. From this data, the rate of substratedissociation, ... mM guanosine, 10 mM MgCl2,50 mM Mes (pH 7) and substrate (5¢-G2CCCUCUAAAAA-3¢)at50°C[6].cSubstrate-cleavage reaction (exogenous guanosine-mediated) of the substrate (5¢-CUUAAAAA-3 ) using ... from these plots and are the average of two independent assays. All data points between the two independent assays have a standard deviation < 15%.(C) Non-linear least squares fit to the Michaelis–Menten...
  • 13
  • 761
  • 0
Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

... respectively[39]. The structure- based calculations provide a DCp of )4 07 calÆmol )1 ÆK )1 and DASAapolar and DASApolar of )1 354 and )7 77 A ˚2, indicating that more of the apolarresidues are buried on complex ... program[41]. The DCpwas calculated using the following equa-tion:DCp¼ 0:45DASAapolarÀ 0:26 ASApolarwhere DASAapolar and DASApolarare the changes inASA of the apolar and polar residues, ... experimental thermodynamic parameters and structure- based calculated parameters based on sur-face area parameterization. This approach is clearlyan approximation; according to this parameterization,the...
  • 11
  • 549
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... spectrometry and assigned to be free CoA(peak 1), acetyl-CoA (peak 2) (Z)-3-MG-5-CoA (peak 3) (E)-3-MG-5-CoA (peak 4) and (E)-3-MG-1-CoA (peak 5). The determined relative molec-ular masses (MW) of the ... oligonucleotides AUHFW 5¢-AGCTCATATTCTCTGTGCGAGTCCTCGATGGC-3¢ and AUH RP 5¢-GCCATCGAGGACTCGCACAGAGAATATGAGCT-3¢ (the c.719C>T mutation leadingto the amino acid exchange A2 40V is underlined). The AUH ... (199 9) Characterisation and mitochondrial localisa-tion of AUH, an AU-specific RNA-binding enoyl-CoAhydratase. Gene 228, 85–91.17 Nakagawa J & Moroni C (199 7) A 20-amino-acidautonomous RNA-binding...
  • 11
  • 625
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

... chromosomal B. subtilis DNA as template and the oligonucleotides 5¢-TTGGTGGGATCCGTGACTCGAGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTTGTCGACTTATCGCACACTATAGCTTGATG-3¢ as primers(restriction sites are underlined ... isopentenyl diphosphate isomerases were found in the genomes of Archaea and of certain eubacteria but not in the genomes of fungi, animals and plants. The analysis of the occurrence of idi-1 and idi-2 ... and the Thermococcales together with the Methanobacteriales (bootstrap value: 77 %) are groupedinto clusters. The presently available data suggest that Cyano-bacteria, Bacillales and Lactobacillales...
  • 12
  • 692
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... h and then cut with ClaI (C and D).DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C). The DNA was then electrotransferred ... mitoDC-81 alkylates mtDNA in mitochondria or cells. The reasons for the lack of alkylation of mtDNAwithin mitochondria by mitoDC-81 are unclear. The localconcentrations of mitoDC-81 and DNA, and the ... present and was independent of the size of the DNAfragment (Fig. 3A, lane 1). As mtDNA in vivo is negativelysupercoiled it was also important to compare the ability of mitoDC-81 to alkylate linear,...
  • 10
  • 638
  • 0
Tài liệu Báo cáo khoa học: Reductive nitrosylation of ferric human serum heme-albumin docx

Tài liệu Báo cáo khoa học: Reductive nitrosylation of ferric human serum heme-albumin docx

... 5.5 and 7.5, and at 20 °C. (A) Normalized averaged time course of HSA -heme- Fe(II) nitrosylationat pH 5.5 (trace a) and 7.5 (trace b), and at 20 °C. The time course analysis according to Eqn ( 6) ... 104m )1 Æcm )1 . The optical absorptionspectra of HSA -heme- Fe(II) and HSA -heme- Fe(II)-NOTable 1. Values of thermodynamic and kinetic parameters for reductive nitrosylation of HSA -heme- Fe(III), at ... concentration (i.e. [NO ]). The analy-sis of data according to Eqn ( 2) allowed the values of kon(= 1.3 · 104m )1 Æs )1 ) and koff(= 2.0 · 10 )1 s )1 ) to be determined, at pH 5.5 and 20 °C (Table...
  • 12
  • 594
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... found to have a molecular mass of 64 kDa, and to containtwo tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involvedin ... (B)Macula (M) and transitional epithelial (TE) regions. Intense hybridiza-tion signals were observed in the cells at the periphery of the mac-ula (arrowhead) and in transitional epithelial ... to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T (200 0) Molecularmechanism of the nacreous layer formation in Pinctadamaxima. Biochem...
  • 12
  • 568
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015