Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth Amelia Smyk1, Magdalena Szuminska1, Katarzyna A. Uniewicz1, ... SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2 ⁄ PDIP46 ... 1).There are at least two splicing variants of the human POLDIP3 gene encoding proteins of 421 amino acids with a molecular mass of 46 kDa and 392 amino acids with a molecular mass of 43 kDa, which differ...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf
... signalswere determined by immunoblotting and by autoradiography asindicated. (B) The autoradiographic Cdc45 bands were quantified with the programPHORETIX 1D ADVANCED, and depicted in a graph. A BFig. ... analysis of DNA polymerase d p125 and p50 subunits, PCNA and replication protein A p70 and p32 subunits inwhole -cell lysates of serum-starved T98G cells. (D) Immunofluorescence analysis of Cdc45 ... ana-lysis revealed that the band marked with an asterisk was recombin-ant Cdc45, the band above Cdc45 was heat shock protein 70 and the bands below were cytokeratin 1 and 9. Four microlitres of...
- 16
- 504
- 0
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt
... 5¢-TCATGCTGGTTGAGACTGGA-3¢ and 5¢-CCAGGTGTGGAGCAAGGCAG-3¢) and a 938 bp fragment of promoter 3 (primers, 5¢-CTCACAGCAGCCAGTAAGTG-3¢ and 5¢-ACTCACAGGCTCTGGGGCTG-3¢) were amplified using a Taq polymerase ... expressed in Neuro 2a cells (a and d) . Golgi apparatus was visualized using anti-Gogi p58 protein IgG 48 h after transfection (b and e). Merged images showed thatisofrom 1 was distributed to cellular ... of KLK11 isoforms,isoform 1 and isoform 2, have been predicted from cDNA sequences. Iso-form 1 has been isolated from human hippocampus, whereas isoform 2 hasbeen isolated from prostate. However,...
- 9
- 544
- 0
Tài liệu Báo cáo khoa học: Human intrinsic factor expressed in the plant Arabidopsis thaliana doc
... (67 kDa) and cytochrome c (CC, 12 kDa) are marked with arrows. Inset: SDS/PAGE of the isolatedpreparation. Coomassie stained lanes: 1,standards; 2, recombinant IF from plants.PAS stained lanes: ... for a long time [5,7]. The disease is caused by lack of IF and without treatment by injections of 1 mg of the vitamin at regular intervals this condition is lethal [8]. The major disadvantages with ... Materials and meth-ods). The IF elution peak (Fig. 1) practically coincided with that of BSA (67 kDa). The fractions with red protein obtained after gel filtration were pooled and analyzed bySDS/PAGE...
- 6
- 492
- 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
... fromincorrect data present in corpora.In order to better understand what makes goodevaluation data (and metrics), we designed and im-plemented an experiment in which human judgesevaluated German string ... realisation system is developed, and not only globally, but also at thelevel of individual sentences.Another major consideration in evaluation is what to take as the gold standard. The easiest ... thesis several models of realisation ranking arepresented and evaluated against the original cor-pus text. Chapter 8 describes a small human- basedexperiment, where 7 native English speakers rankthe...
- 9
- 479
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... based on its characteristic retention time and the absorption spectrum of each retinoid standard.Isomerohydrolase activity was calculated from the area of the 11cROL and 13cROL peaks and expressed ... transcriptase sys-tem (Applied Biosystems Inc.) with an oligo-dT primer and random hexamer. To eliminate potential genomic DNA contamination, the RNA from the eyecups were treated with DNase I and cDNA ... applied to positivelycharged glass slides (VWR, Radnor, PA, USA) and air driedat 25 °C. The dissociated retinal cells on the slides were fixed with 4% paraformaldehyde in NaCl ⁄ Pifor 20 min at...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... as a D , b D , and c D , respectively, and the a and b subunits of the reactivase are abbrevi-ated as a R and bR, respectively, molar ratios of a D , b D ,c D , a R and bRin bands i and ... was incubated with the reactivase in the presence of ADP and Mg2+ and followed by nondenaturing PAGE, the bands of theenzyme and the reactivase were markedly reducedin density, and two bands ... Hieda N, Yamanishi M, Shibata N &Toraya T (2005) Crystallization and preliminary X-rayanalysis of molecular chaperone-like diol dehydratase-reactivating factor in ADP-bound and nucleotide-freeforms....
- 13
- 620
- 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... indicated were treated with recombinant human TRAIL for 4 h and cell survival was assessed using the MTT assay. Cas-pase 3 activity was assessed by measuring degradation of the Ac-DEVD-pNA peptide. ... of intact Bid by Itch. This leads to thesuggestion that removal of tBid by proteasomal degra-dation leads to an increase in Bid cleavage, resulting inthe disappearance of both Bid and tBid. ... reagents and the recombinant human TRAIL ⁄ APO 2 ligand were purchased from Invitrogen and Feldan Bio (St-Laurent, QC, Canada), respectively. Thecaspase 3 substrate (Ac-DEVD-pNA) and the inhibitorsubstrate...
- 12
- 718
- 0
Tài liệu Báo cáo khoa học: Plant–pathogen interactions: what is proteomics telling us? doc
... Universidade Cato´lica de Brası´lia,Brazil6 Departamento de Biologia, Universidade Federal de Juiz de Fora, Brazil7 Embrapa Arroz e Feija˜o, Goiaˆnia, BrazilIntroductionPlant–pathogen ... Filho H, Machado MA et al. (2003)Proteome analysis of the plant pathogen Xylella fas-tidiosa reveals major cellular and extracellular proteins and a peculiar codon bias distribution. Proteomics ... intracellularsensitive perception of pathogens and the recognition of pathogen-associated molecular patterns, such aslipopolysaccharides and flagellin, lead to the activation of the plant basal...
- 16
- 446
- 0
Tài liệu Báo cáo khoa học: Structural basis for cyclodextrin recognition by Thermoactinomyces vulgaris cyclo⁄maltodextrin-binding protein ppt
... tonozuka@cc.tuat.ac.jp*Present addressDepartment of Chemistry and MaterialEngineering, Shinshu University, Nagano,JapanDatabaseThe atomic coordinates and structural fac-tors described in this ... maltodextrin-binding protein [21] and A. acidocaldarius maltose ⁄ maltodextrin-binding protein [22], was unsuccessful. Therefore, a MAD data collection of the SeMet derivative was also carried ... (EcoMBP) and other bacterial sugar-binding proteins, TvuCMBP consists of two domains,an N- and a C-domain, both of which are composed of a central b-sheetsurrounded by a- helices; the domains are...
- 12
- 540
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)